WWW.MASH.DOBROTA.BIZ
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - онлайн публикации
 

«БИОЛОГИЧЕСКИ АКТИВНЫХ СОЕДИНЕНИЙ Н.П. Максимова, Е.А. Храмцова, И.Н. Феклистова, В.В. Лысак, О.В. Фомина, Ю.М. Кулешова, С.С. Жардецкий, Е.Г. Веремеенко, М. Садрния Белорусский государственный ...»

УДК 577.21 + 579.25. 579.22; 577.213

ГЕНЕТИЧЕСКИЕ ПОДХОДЫ СОЗДАНИЯ ШТАММОВ-ПРОДУЦЕНТОВ

БИОЛОГИЧЕСКИ АКТИВНЫХ СОЕДИНЕНИЙ

Н.П. Максимова, Е.А. Храмцова, И.Н. Феклистова, В.В. Лысак, О.В. Фомина,

Ю.М. Кулешова, С.С. Жардецкий, Е.Г. Веремеенко, М. Садрния

Белорусский государственный университет, Минск, Республика Беларусь

Одной из важнейших задач современной биотехнологии является создание

высокопродуктивных штаммов микроорганизмов, способных к сверхсинтезу биологически активных соединений. Особенно перспективными в этом отношении являются бактерии рода Pseudomonas, обладающие природной способностью синтезировать свыше 300 различных наименований антимикробных соединений, фитогормоны, разнообразные микробные пигменты, гидролитические ферменты, а также соединения, стимулирующие иммунитет растений и повышающих их устойчивость к неблагоприятным факторам окружающей среды. За последние два десятилетия в этом направлении достигнуты значительные успехи, обусловленные как применением современных генетических и генно-инженерных подходов, так и совершенствованием традиционных методов селекции микроорганизмов .

На биологическом факультете руководством профессора Ю.К. Фомичева в сформировано новое научное направление, связанное с расшифровкой биохимических и генетических основ синтеза биологически активных соединений ароматической и гетероциклической природы у представителей Pseudomonas различных физиологических групп .



В настоящее время у ряда природных штаммов этого рода изучены пути и механизмы регуляции синтеза первичных и вторичных метаболитов – аминокислот, пигментов, антибиотиков, стимуляторов роста растений, а также ферментов, участвующих в их метаболизме. Созданы генетические подходы конструирования штаммовпродуцентов ряда микробных метаболитов и ферментов, перспективных в биотехнологическом отношении – феназиновых антибиотиков, пиовердинов, ароматических аминокислот, стимуляторов роста растений (ИУК и гиббереллинов), АЦКдезаминазы и др. Разработаны приемы получения новых биопестицидных препаратов, пригодных для практического использования .

Формированию данного научного направления предшествовал комплекс работ, направленных на создание коллекции полезных в практическом отношении природных и генетически маркированных штаммов Pseudomonas [1], разработку новых приемов их генетического анализа [2-4], поиск и характеристика плазмид – потенциальных векторов и хромосоммобилизующих факторов [5-7] .

Наиболее интересным среди охарактеризованных представителей Pseudomonas оказался выделенный из природных источников штамм факультативных метилотрофных бактерий P. putida М (коллекционный номер P. рutida КМБУ 4308) [8], позднее охарактеризованный как представитель PGPR-группы Pseudomonas (Plant GrowthPromoting Rhizobacteria - ризобактерии, способствующие росту растений [8-14]). В клетках изучаемого штамма была обнаружена конъюгативная плазмида рМ3, являющаяся R-фактором широкого круга хозяев, детерминирующая устойчивость к стрептомицину и тетрациклину [15]. Уникальной особенностью данной плазмиды явилась ее структурная нестабильность (утрата участка, кодирующего тетрациклин-резистентность) [9], а также "температурная нестабильность" при 370С в клетках гетерологичных хозяев, в частности, представителях семейства Enterobacteriaceae [16] Плазмида рМ3 была предложена для разработки нового инструмента транспозонного мутагенеза [17-19]. Установлена принадлежность рМ3 к Inc P-9 группе несовеместимости [16, 19] .



Высокий уровень стабильности данной плазмиды в клетках собственного хозяина P. putida М, а также других представителей Pseudomonas послужил основанием для развития работ по созданию вектора рМТ2 (минирепликон рМ3) для клонирования генов в системе Pseudomonas [20], а также бирепликонного вектора регулируемой экспрессии рРS10 (сконструированного на основе репликонов плазмид рМК1 [5], pBR322 и par-локуса плазмиды рМ3), пригодного для клонирования генов в системе Pseudomonas – E. coli. [21, 22]. Плазмида рМ3 была предложена в качестве хромосоммобилизующего фактора для бактерий, не имеющих собственных систем генетического обмена. В серии более поздних работ М.А. Титок был проведен детальный молекулярно-генетический анализ плазмиды рМ3, изучена организация ее репликативного аппарата и осуществлена идентификация локусов, ответственных за репликацию и температурную нестабильность в гетерологичных хозяевах [23, 24 и др.]. На основе плазмиды широкого круга хозяев pRK2013, получены доноры Hfr-типа бактерий P. mendocina, передающие хромосому в конъюгационных скрещиваниях с частотой 10-4. Осуществлено картирование восемнадцати генов хромосомы этого штамма, включая гены биосинтеза ароматических аминокислот [25-28] .

В настоящем обзоре обобщены результаты исследований, связанных с расшифровкой особенностей метаболизма ароматических соединений у перспективных в биотехнологическом отношении бактерий различных физиологических групп, в том числе, представителей Pseudomonas, а также разработкой новых подходов использования биосинтетического потенциала данных организмов и создания на их основе новых штаммов-продуцентов биологически активных соединений ароматической природы первичного и вторичного происхождения .

СИНТЕЗ ПЕРВИЧНЫХ МЕТАБОЛИТОВ АРОМАТИЧЕСКОЙ ПРИРОДЫ

МЕТИЛОТРОФНЫМИ БАКТЕРИЯМИ

Метилотрофные бактерии представляют собой гетерогенную, интересную в биохимическом отношении группу микроорганизмов, в том числе представителей рода Pseudomonas, у которых, несмотря на уникальность питательных потребностей (способность утилизировать С1-соединения), биосинтетический аппарат имеет много общего с хорошо изученными в этом отношении представителями других физиологических групп бактерий. Принимая во внимание, что ароматический путь является частью интегральной метаболической системы, которая обеспечивает синтез важнейших клеточных метаболитов, в том числе, значимых в плане их практического использования, представлялось интересным определить метаболический потенциал бактерий, способных утилизировать метилсодержащие соединения и получить информацию о возможности их использования для создания на продуцентов ароматических и гетероциклических соединений микробного происхождения .

В ходе выполнения исследований разработаны критерии отбора перспективных метилотрофных штаммов, включающие поиск объектов с высоким уровнем синтеза ключевого фермента ароматического пути ДАГФ





-синтазы, первичную оценку их способности к продукции микробных метаболитов ароматической природы, рост на простых источниках углерода и энергии, какими являются метанол и его производные .

Использование такого подхода позволило выделить и охарактеризовать ряд новых, ранее не описанных штаммов, в частности, облигатного метилотрофа M. mucogenes M75, имеющего КДФГА/ТА вариант РМФ-цикла и характеризующегося высокими активностями трех основных ферментов метилотрофного метаболизма: 3гексулозофосфат-синтазы, НАДФ+-глюкозо-6-фосфатдегидроге-назы и 2-кето-3-дезоксифосфоглюконат-альдолазы [29-31], а также факультативного метилотрофа P. putida M, обладающего уникальным путем утилизации метанола – за счет активности алкогольдегидрогеназы с широкой субстратной специфичностью в отношении низших спиртов. Однако, основной интерес к бактериям M. mucogenes M75 был связан с особенностями их ароматического метаболизма: при тестировании на способность к синтезу ароматических метаболитов у них был выявлена продукция 2,3-диоксибензоата [14, 32]. Известно, что это соединение является стимулятором роста различных организмов и, кроме того, обладает способностью связывать кислородные радикалы и защищать клетки от их токсического действия .

Впервые у облигатных метилотрофных бактерий, обладающих КДФГА/ТА вариантом РМФ-цикла, зарегистрирована связь метилотрофного и ароматического метаболизма. Роль связующих элементов при этом выполняют промежуточные продукты РМФ-цикла – фосфоенолпируват и эриторозо-4-фосфат, которые одновременно являются субстратами ДАГФ-синтазы и поставляются в ароматический путь в ходе утилизации метанола бактериальными клетками. Показано, что уровень удельной активности ДАГФсинтазы находится в прямой зависимости от концентрации источника углерода (метанола) в среде культивирования бактерий, что подтверждает гипотезу о тесной связи и согласованности процессов ассимиляции С1-соединений и метаболизма ароматических соединений [32-34] .

С учетом физиологических и биохимических особенностей метилотрофных бактерий разработаны подходы получения ауксотрофных и регуляторных мутантов следующих фенотипов: Aro-, Trp-, Phe-, Tyr-, Nic-, Pyr-, Phu-, Tyu-, 5MTR и 6FTR, которые были использованы для изучения регуляции метаболизма ароматических соединений первичного и вторичного происхождения [33-42]. Анализ созданной коллекции метилотрофных бактерий на предмет их возможного практического использования позволил отобрать ряд мутантных штаммов, которые были предложены в качестве индикаторных тест-культур для определения ароматических аминокислот триптофана, фенилаланина, тирозина и никотиновой кислоты в различных средах [43-46]. Тесткультуры нашли применение для выявления экскретирующих ароматические аминокислоты регуляторных мутантов метилотрофных бактерий и отбора среди них продуцентов аминокислот [35, 37, 43, 47] .

У ряда метилотрофных штаммов изучено строение и механизмы регуляции активности и синтеза 3-дезокси-D-арабиногептулозонат-7-фосфат-синтазы (ДАГФсинтазы) (табл. 1). Установлено, что этот фермент у всех изучаемых метилотрофов имеет типичное для большинства известных организмов строение – представлен тремя изоферментами (у M. mucogenes M75, M. flagellatum KТ и M. capsulatus ИМ) либо двумя изоферментами (у P. methylica 2 и P. putida M) [32-34, 48]. На биохимическом уровне ДАГФ-синтаза этих бактерий регулируется путем ретроингибирования, причем характер этого процесса зависит от изоферментного состава фермента. Так, активность ДАГФсинтазы у M. mucоgenes M75, M. flagellatum КТ и M. capsulatus ИМ ингибируется тремя ароматическими аминокислотами (триптофаном, фенилаланином и тирозином) [32-34, 40, 42], а у P. methylica 2 и P. putida M – триптофаном и тирозином [32, 40, 48]. По своему составу и способу аллостерической регуляции ДАГФ-синтаза облигатных метилотрофных бактерий рода Methylobacillus и факультативных M. capsulatus ИМ наиболее близка к одноименному ферменту бактерий семейства Enterobacteriaceae, для которых характерно наличие трех изоферментов в его составе. Причем вклад каждого из изоферментов в суммарную активность ДАГФ-синтазы у Methylobacillus сходен с бактериями E. coli, поскольку изофермент ДАГФС-[Phe] у последних также является «доминантным» и обеспечивает 80 % общей активности фермента. ДАГФ-синтаза факультативного метилотрофа M. capsulatus ИМ имеет сходство с данным ферментом других представителей энтеробактерий, например Erwinia, у которых все три изофермента по активности равнозначны. Двухизоферментный состав ДАГФ-синтазы у метилотрофных бактерий P. methylica 2 и P. putida M является типичным для представителей Pseudomonas, при этом основной изофермент у них – ДАГФС-[Tyr] .

Разработка нового подхода изучения регуляции синтеза ДАГФ-синтазы с использованием мутантов, имеющих блоки того или иного участка шикиматного пути (Aro- -фенотипа), позволила впервые обнаружить этот механизм не только у метилотрофных бактерий (M. flagellatum KT, M. capsulatus ИМ и P. putida M) (табл. 1), но и ряда других представителей рода Pseudomonas [49], для которых ранее этот тип регуляции известен не был. На основании полученных данных сделан вывод о широком распространении среди бактерий различных физиологических групп механизма регуляции синтеза ДАГФ-синтазы путем репрессии. При этом, число Аro- генов не соответствует количеству обнаруженных апорепрессоров: у бактерий M. flagellatum KТ из трех aro-генов репрессии подвержены только два – aroH и aroF, у M. capsulatus ИМ – только один – aroH, а у P. putida M из двух генов aroH и aroF репрессируется только последний .

–  –  –

При изучении механизмов синтеза триптофана установлено, что этот участок ароматического пути у облигатных метилотрофных бактерий регулируется посредством двойного контроля – репрессии trpE-, trpD- и trpC-генов и ретроингибирования ключевого фермента антранилат-синтазы триптофаном, чем последние сходны с большинством известных бактерий [33, 40, 41]. У бактерий P. putida M зарегистрирована индукция синтеза триптофан-синтазы индол-3-глицерофосфатом, что характерно лишь для некоторых представителей Pseudomonas [32, 50, 51] .

Получены регуляторные, продуцирующие триптофан мутанты облигатных и факультативных метилотрофных бактерий, для которых установлена генетическая основа сверхсинтеза данной аминокислоты [37]. Отобран мутантный штамм P. putida M15 – продуцент триптофан-синтазы (уровень синтеза 200 нмоль/минмг белка), пригодный для получения данного фермента в больших масштабах, а также микробного синтеза Lтриптофана из индола и серина [47]. Это открывает возможности дальнейшего усовершенствования полученных мутантов и направленного конструирования на их основе штаммов – продуцентов триптофана. В ходе изучения регуляции триптофанового пути у факультативного метилотрофа P. putida M разработаны новые приемы получения одного из биосинтетических предшественников триптофана – 5-фосфорибозилпирофосфата, а также способы его определения с помощью ферментативного анализа [52, 53] .

Исследование механизмов синтеза аминокислот фенилаланина и тирозина показало, что регуляция этого процесса у облигатного метилотрофа M. mucоgenes M75 осуществляется на транскрипционном уровне путем репрессии генов, контролирующих синтез хоризматмутазы и префенатдегидратазы, тирозином и дополнительного ингибирования активности префенатдегидратазы фенилаланином [33, 54]. У бактерий P .

putida M обнаружен новый уникальный фермент фенилаланингидроксилаза, широко распространенный лишь у эукариотических организмов и осуществляющий превращение фенилаланина в тирозин [32, 51, 55]. У бактерий этот путь является дополнительным к основному: хоризмат префенат тир озин. Регуляция синтеза фенилаланина у бактерий этого штамма осуществляется посредством ингибирования активности префенатдегидратазы фенилаланином и триптофаном. Генетический контроль синтеза тирозина осуществляется путем репрессии tyrA-гена триптофаном и индукции синтеза фенилаланингидроксилазы фенилаланинином [55] .

Составлены интегральные схемы биосинтеза ароматических аминокислот у метилотрофных бактерий, которые демонстрируют ключевые регуляторные звенья и возможные «рычаги» управления метаболизмом для направленной дерегуляции ароматического пути при создании штаммов-продуцентов (рис. 1 и 2) [14, 33, 56] .

В ходе дальнейшего анализа возможностей биотехнологического использования метилотрофных бактерий в качестве продуцентов тех или иных ароматических метаболитов, было обращено внимание на то, что клетки облигатного метилортрофа M .

mucogenes M75 синтезируют и выделяют в среду 2,3-диоксибензоат, Выход этого соединения у них составляет 180 мг/л [32], что значительно превышает охарактеризованные ранее бактериальные продуценты [57] .

–  –  –

СИНТЕЗ ВТОРИЧНЫХ МЕТАБОЛИТОВ АРОМАТИЧЕСКОЙ ПРИРОДЫ

БАКТЕРИЯМИ PSEUDOMONAS

Флуоресцирующий пигмент пиовердин Рм бактерий P. putida M. При анализе бактерий P. putida M на предмет способности синтезировать вторичные метаболиты ароматической природы, было установлено, что они продуцируют флуоресцирующий пигмент пиовердин Рм, обладающий антимикробной активностью в отношении широкого спектра микроорганизмов, в том числе, фитопатогенных [13, 14, 32, 58, 59]. Анализ молекулярного строения пигмента показал, что в его состав помимо ароматического (диоксихинолинового) ядра входит пептид, включающий пять различных аминокислот:

треонин, серин, лизин, аспарагиновую кислоту и N-оксиорнитин в молярном соотношении 3 : 2 : 1 : 1 : 1 [13, 32, 59] .

Синтез пиовердина Рм и его регуляция. Для исследования путей синтеза диоксихинолинового ядра пиовердина Рм был разработан оригинальный подход выявления его биосинтетических предшественников с использованием зависимых по ароматическим аминокислотам и азотистым основаниям мутантов (Aro-- и Pyr--мутантов) .

Клетки мутантного штамма P. putida M1 (аro1phu1-генотипа), имеющего блок одного из этапов шикиматного пути, а также дефект фенилаланингидрокислазы (фермента, превращающего фенилаланин в тирозин), выращивали в условиях лимита и избытка каждой из ароматических аминокислот (L-триптофана, L-фенилаланина и L-тирозина) и регистрировали продукцию пигмента. В результате было установлено, что восстановление способности синтезировать пигмент у аro1phu1 мутантных бактерий регистрировалась только при избытке в среде L-фенилаланина (100 мкг/мл), что указывало на то, что одним из предшественников диоксихинолинового ядра пиовердина Рм (его ароматической части) является L-фенилаланин [60, 63]. С использованием Pyr--мутантов установлено, что вторым предшественником является дигидрооротат [13, 61, 62, 63]. На основании полученных данных предложена гипотетическая схема синтеза пиовердина Рм (рис. 3) [13, 14, 62] .

–  –  –

I – фенилаланин; II дигидрооротат; III VII предполагаемые предшественники; VIII пиовердин Pм;. R1- карбоновая кислота или ее амид. R2 - пептидная часть Рисунок 3 – Предполагаемая схема пути синтеза диоксихинолинового ядра пиовердина Pм из фенилаланина и дигидрооротата у бактерий P. putida М .

В ходе изучения регуляции cинтеза пиовердина Рм было показано, что этот процесс репрессируется ионами Fe3+ и других металлов (Ni2+, Sn2+, W6+), а также глюкозой. Как указывалось выше, синтез ароматической компоненты диоксихинолинового ядра – фенилаланина регулируется на уровне ДАГФ-синтазы путем ретроингибирования фермента триптофаном и тирозином, а также репрессии его синтеза фенилаланином и тирозином [48, 51]. На уровне фенилаланинового пути – путем ингибирование активности префенатдегидратазы фенилаланином и триптофаном [55]. Синтез предшественника диоксихинолинового ядра пигмента дигидрооротата регулируется посредством ингибирования активности аспартат-транскарбамоилазы ЦТФ, ГТФ, УТФ и пирофосфатом, а также стимуляции фенилаланином [13, 61] .

Физико-химические свойства пиовердина Рм. Для изучения этого вопроса был разработан новый метод быстрого и качественного выделения пигмента путем предварительного сгущения раствора с помощью процедуры замораживания-оттаивания и последующей колоночной хроматографии на амберлите XAD-4, что позволило получить препарат пигмента высокой степени очистки (рис. 4). Определена молекулярная масса Рисунок 4 – Профиль элюции очищенного препарата пиовердина Pм на жидкостном хроматографе с масс-спектрометрическим детектором LCMS-QP8000a пиовердина Рм – 1211 Да [32], что полностью соответствует расчетной величине по результатам аминокислотного анализа [59]. Было установлено, что пиовердин Pм способен хелатировать ионы многих металлов: Fe3+, Zn2+, Ni2+, Co2+, Sn2+, Cu2+, Cd2+, Mo6+, Mn2+ и Wо6+ [13, 14, 59], при этом у него изменяется длина волны максимума поглощения, а также его величина. Хелатирующая активность пиовердина Рм обеспечивает бактериям P. putida М антимикробную активность в отношении широкого круга про- и эукариотических микроорганизмов [13, 32, 59] .

Антирадикальная активность пиовердина Рм. Использование методики перекисного восстановления в системе ПНТХ (ПНТБ)-рибофлавин позволило впервые зарегистрировать у пиовердинов наличие выраженной антирадикальной активности. По этому показателю изучаемый пигмент сравним с известными органическими антиоксидантами природного происхождения. В частности, 50 %-ое ингибирование свободнорадикальных процессов в присутствии пиовердина Pм наблюдалось при его концентрации 25 мкг/мл, а максимальный уровень (около 90%) – при 90 мкг/мл (рис. 5), что сопоставимо с действием меланина и других полифенолов (табл. 2) [64-66]. Кроме того, пиовердин Рм практически не обладает цитотоксичностью в отношении клеток человека .

интенсивность свободно-радикальной реакции, %

–  –  –

Полученные результаты открывают перспективы для использования пиовердина Pм в качестве нового антирадикального агента. Возможной областью его применения может быть медицина – в качестве нового полифункциональным препарата, обладающего одновременно антирадикальным и противомикробным действием .

Установлено, что антирадикальная активность пигмента связана с его хелатирующей способностью. Образование комплексов пиовердина с ионами Co2+, Zn2+, Cu2+ и Fe3+ угнетает его антирадикальную активность, тогда при как связывании с ионами Mn2+ снижения таковой не наблюдается, несмотря на то, что ионы марганца способны образовывать с ним прочные комплексы [65, 67] .

Получение и характеристика штаммов-продуцентов пиовердина Рм. С использованием нитрозогуанидинового и транспозонного (Тn5) мутагенеза и последующей селекции на устойчивость к 5-фторурацилу, ЭДТА или 6флуорофенилаланину отобраны мутанты бактерий P. putida М, характеризующиеся повышенным в 2-3 раза по сравнению с бактериями дикого типа уровнем продукции пиовердина Pм и способные к его синтезу в присутствии ионов железа (например, мутант F17) (рис. 6) [68-70]. При изучении динамики синтеза пиовердина мутантными бактериями на примере штамма М8 было показано, что его клетки начинают синтезировать пигмент в логарифмической фазе роста, в то время как у бактерий дикого типа его синтез регистрируется только в стационарной фазе (рис. 7), что характерно для вторичных метаболитов в целом. Молекулярно-генетическая основа этого явления в настоящее время еще не расшифрована .

–  –  –

В скобках указан уровень синтеза пигмента, * – способен к синтезу пиовердина в среде, содержащей 10 мкг/мл FeSO4·7H2O Рисунок 6 – Схема получения мутантных штаммов P. putida М, способных к сверхсинтезу пиовердина Pм .

Масс-спектрометрический анализ пиовердинов, синтезируемых мутантными бактериями P. putida М выявил отличия в их молекулярных массах, что связано с изменением аминокислотного состава пептидной части молекулы (рис. 8, табл. 3) .

–  –  –

При этом изменения в строения пептидной части пиовердинов наблюдалось только у мутантов, полученных с помощью нитрозогуанидина (мутанты М8 и С11), аминокислотный состав пигмента у мутанта, полученного с помощью Tn5-мутагенеза оставался прежним (в частности, у М8 и М17). Логично предположить, что замена аминокислот и увеличение их количества в пептидной части пиовердина обусловлена изменением специфичности ферментов, обеспечивающих ее образование путем нерибосомного синтеза .

Было установлено, что пиовердины, синтезируемые бактериями мутантных штаммов проявляют перекрестную антимикробную активность по отношению друг к другу и бактериям дикото типа P. putida М (рис. 9). Иными словами, изменение аминокислотного состава пептидной части пиовердина «индуцирует» у синтезирующих его бактерий проявление антагонизма в отношении других мутантов. Например, клетки дикого типа P .

putida M, так же как и мутантного штамма С11, утрачивают способность поглощать пиовердины других мутнтов, что проявляется в появлении зон задержки их роста .

Наоборот, пиовердины М8 и F17 (штамм М17 является транспозоновым вариантом М8) имеют одинаковое строение и потому взаимозаменяют друг друга. Полученные данные позволяют сделать вывод, что спектр антагонистической активности пиовердина Рм определяется уникальностью строения его пептидной составляющей. Изменяя состав и композицию аминокислот в этой части молекулы пигмента можно получать мутантные штаммы P. putida с более широким спектром антибактериальной активности .

Обсуждая механизмы сверхсинтеза пиовердинов у изучаемых мутантных бактерий, можно предположить, что одной из причин этого явления может быть утрата афинности мутантных пиовердинов к рецепторам на поверхности собственных клеток в результате изменения их аминокислотного состава, следствием чего является блокирование транспорта ионов железа внутрь клеток и, как результат этого, дерепрессия синтеза пигмента. Вместе с тем, нельзя полностью исключать и иные механизмы сверхинтеза пиовердинов, например, инактивацю в результате мутации негативного регулятора синтеза пиовердинов – Fur-белка .



Клонирование pfrI-гена P. putida М. Интересным является подход повышения уровня синтеза пиовердина путем клонирования гена рfrI, который играет определяющую роль в позитивной регуляции синтеза пиовердинов бактерий Pseudomonas. Продуктом, этого гена является PfrI--фактор – гомолог PvdS-белка P. aeruginosa и PbrA-белка P .

fluorescens M114 [72]. Эти белки классифицируются как альтернативные экстрацитоплазматические -факторы 70 семе йства, необходимые для инициации транскрипции практически всех известных генов синтеза пиовердинов. В ходе работы осуществлено клонирование и секвенирование рfrI-гена. Для исследования полномасштабного гена pfrI, включающего собственную регуляторную

–  –  –

область, с помощью программ BLASTP2.2.1 (NCBI сайт http://www.ncbi.nlm.nih.gov)и OligoCalc были сконструированы праймеры, позволяющие считывать последовательность ДНК pfrI, начиная от области связывания Fur-белка (частично перекрывается с «–35 областью» промотора) до терминирующей шпильки. В состав праймеров были включены сайты рестрикции для Bam HI (рис. 10):

F 5’ – gcGGATCCGTATTTGACAATCATTATCATTCT – 3’ R 5’ – gcGGATCCGGGCGGGAGCGGTTT – 3’ Рисунок 10 – Праймеры, комплементарные области связывания Fur-белка с ДНК промоторно-операторной области (F) и области терминирующей шпильки (R) pfrI-гена бактерий P. putida. Подчеркнуты сайты рестрикции Bam HI Синтез фрагмента ДНК, соответствующий искомому гену был осуществлен с помощью ПЦР на матрице хромосомной ДНК P. putida М. Анализ длины полученного продукта проводили при помощи электрофореза в 1%-ом агарозном геле (буферная система ТАЕ). Результаты эксперимента, представленные на рис. 11, позволяют сделать вывод о том, что изучаемый фрагмент ДНК имеет длину около 800 п.н .

Следует отметить, что размер полученного ПЦР-продукта не соответствовал данным, приведеным другими авторами. В частности, для гомологичного гена P .

aeruginosa (pvdS) показано, что его длина составляет примерно 500 п.н., для pbrA P .

fluorescens – 700 п.н. Для идентификации полученного нами ПЦР-фрагмента было необходимо исследование его нуклеотидной последовательности, а также анализ степени его родства с соответствующими генами альтернативных экстрацитоплазматических факторов бактерий рода Pseudomonas .

Для проведения сиквенс-аназа ПЦР-фрагмент pfrI-гена был обработан эндонуклеазой BamHI и лигирован с линеаризованным той же рестриктазой мультикопийным вектором pUC19. Полученной рекомбинантной плазмидой pUC19pfrI трансформировали клетки бактерий E. coli DH5. Для реакции секвенирования использовали ДНК гибридной плазмиды pUC19pfrI. Анализ нуклеотидных последовательностей клонированного фрагмента показал, что он имеет длину 802 п.н. (с праймерами, включенными в продукт

–  –  –

в ходе ПЦР – 818 п.н.) и гомологичен генам, кодирующим синтез сигма-24 подкласса факторов с экстрацитоплазматической функцией (ECF) P. putida GB-1 (93% гомологии), аналогичного ECF -фактора P. putida F1 и P. putida W619 (90% гомологии), ECF 70фактора P. putida KT2440 PfrI (90% гомологии), pfrI-гену P. putida и P. entomophila L48 (89% гомологии), гену железо-зависимого регулятора транскрипции P. fluorescens Pf-5 (82% гомологии), pvdS-гену P. fluorescens (82% гомологии) и гомологам pvdS-гена других представителей Pseudomonas, дендрограмма степени родства которых приведена на рис. 12 .

Высокая степень гомологии нуклеотидной последовательности генов, представленных на дендрограмм, позволяет предположить также сходный аминокислотный состав их продуктов. Дендрограмма степени родства полученного белка с известными ранее 70-факторами экстрацитоплазматической группы (ECF), построенная с помощью интернет-ресурса Blast 2.2, представлена на рис. 13. Анализ родства гипотетического PfrI-белка бактерий P. putida М с уже известными белками – 70факторами ряда других видов рода Pseudomonas позволяет предположить сходные механизмы их действия .

Рисунок 12 – Филогенетическое древо генов, детерминирующих синтез PfrIгомологов у различных представителей Pseudomonas Таким образом, осуществлено клонирование гена pfrI бактерий P. putida М, продуктом которого является белок, относящийся к экстрацитоплазматическим 70факторам и выполняющий роль позитивного регулятора синтеза флуоресцирующих пигментов у бактерий рода Pseudomonas. Полученные данные нашли применение при генно-инженерных разработках штаммов-продуцентов пиовердина Pм на основе бактерий P. putida М, а также при изучении особенностей позитивной регуляции синтеза данного пигмента .

Биотехнологическое использование бактерий P. putida M. Среди множества полезных свойств пиовердинов Pseudomonas – наличие высокого сродства к ионам металлов (константа связывания – 1025-1032) [73]; антибактериальной, антифунгальной и антинематодной активностей [11-14, 74, 75 и др.]; способности к детекции и мобилизации ионов тяжелых металлов, в том числе, радиоактивных, в водных и почвенных экосистемах [76]; способности к биодеградации ксенобиотиков, в том числе цианидов и производных фенантрена [77]; способности улучшать минеральное питание растений [78] и индуцировать у них неспецифическую резистентность [79], наличие антирадикальной активности [64-66], Рисунок 13 – Дендрограмма степени родства 70-факторов с экстрацитоплазматической функцией белков у различных представителей Pseudomonas а также возможности создания конъюгатов пиовердин-антибиотик, обеспечивающих адресную доставку последнего к патогену в организме [80], для разработки подходов биотехнологического использования пиовердинов наибольший интерес представляло применение их в качестве биоконтролирующих растительные патогены агентов .

Выбор объекта исследования – штамма P. putida M для решения этого вопроса был обусловлен его высокой антимикробной активностью как у бактерий дикого типа, так и сверхпродуцентов пиовердина Рм, которая была исследована в отношении 772 различных культур, большинство из которых являются представителями фитопатогенной микрофлоры растений .

Было установлено, что бактерии изучаемых штаммов проявляют антимибактериальную и антифунгальную активности в отношении более 95 % культур [12, 81, 82]. Антагонистическая активность бактерий P. putida M проявлялась также в отношении близкородственных видов Pseudomonas, таких как P. putida, P. fluorescens и P .

aeruginosa, относящихся к флюоресцирующей группе I по классификации Palleroni et al .

Особенно интересным оказалось проявление бактериями P. putida антинематодной активности в отношении возбудителя мелайдогиноза [83]. Было показано, что главную роль в антимикробной активности изучаемых бактерий играет пиовердин Рм [13, 59, 81] .

Не менее интересным свойством бактерий P. putida M оказался их фитостимулирующий эффект, зарегистрированный в отношении более 20-и сельскохозяйственных культур. На уровне проростков увеличение основных показателей роста достигало 2-4 раз [12-14, 32, 84, 85]. Представленная выше информация позволила сделать вывод, что штамм P. putida M является перспективным объектом агробиотехнологии и может быть использован для создания биопестицидных препаратов широкого спектра противомикробного и антинематодного действия, обладающего одновременно ростостимулирующей активностью в отношении ряда сельскохозяйственных культур .

На основе бактерий P. putida M были разработаны биологические препараты Бактофил и Немацид. Последний внедрен в производство на РУП «Новополоцкий завод белково-витаминных концентратов» (Республика Беларусь) (Регистрационный сертификат № 08-0006. TУ РБ 04081814/139-2009 – для защиты растений от нематоды и стимуляции роста растений) .

Антибиотики ароматической природы бактерий P. aurantiaca

Анализ коллекции штаммов ризосферных бактерий рода Pseudomonas PGPR-группы по критерию высокой активности ключевого фермента ароматического пути – ДАГФсинтазы, наличию широкого спектра антимикробной активности в отношении фитопатогенных грибов и бактерий, а также генов, контролирующих синтез антибиотиков ароматического ряда (пирролнитрин, феназиновые антибиотики, 2,4диацетилфлороглюцинол и пиолютеорина) с помощью ПЦР-анализа позволил отобрать штамм P. aurantiaca B-162, синтезирующий комплекс указанных выше соединений и обладающий высокой антимикробной активностью .

Феназиновые антибиотики представляют собой низкомолекулярные гетероциклические азотсодержащие соединения), синтезируемые в ходе реакций ароматического пути. Основу всех соединений данного ряда составляет феназин-1карбоксилат, а феназин, 2-оксифеназин-1-карбоксилат, пиоцианин, оксихлорорафин, гемипиоцианин – его производные (рис. 14). R1 R3

–  –  –

Масс-спектрометрический анализ феназиновых антибиотиков, синтезируемых бактериями P. aurantiaca B-162 показал, что они представлены феназином – C12H8N2 (молекулярная масса 180 Да, максимумы поглощения соответствуют 240 и 369 нм), 1оксифеназином – C12H7N2OH (196 Да, максимумы поглощения соответствуют 260 и 387 нм), а также их общим предшественником – феназин-1,6-дикарбоксилатом (рис. 15 и 16) [86-88] .

Установлено, что исследуемые бактерии являются природными продуцентами феназиновых антибиотиков, уровень продукции которых составляет в оптимизированных условиях 71-76 мг/л, что превышает таковой у известных бактерий Pseudomonas [88] .

Рисунок 15 – Спектр поглощения (А) и масс-спектр (Б) феназина и феназин-1,6дикарбоксилата: 1 – феназин, 2 – феназин-1,6-дикарбоксилат Рисунок 16 – Спектр поглощения (А) и масс-спектр (Б) 1-оксифеназина Пирролнитрин. Масс-спектрометрический анализ позволил выявить у бактерий P. aurantiaca B-162 еще один антибиотик пирролнитрин (рис. 17), уровень синтеза которого соответствует 5,6 мг/л [88,89] .

Б А Рисунок 17 – Спектр поглощения (А) и масс-спектр (Б) пирролнитрина Наибольшая антимикробная активность пирролнитрина проявляется в отношении фитопатогенных грибов A. alternatа и F. culmorum (фунгицидная доза составляет 2,5-3,5 мкг/мл), тогда как бактерицидная доза в отношении фитопатогенных бактерий Pseudomonas и Erwinia в 3,5 раза выше (7,5-12,5 мкг/мл) [88,89] .

Регуляция синтеза феназиновых антибиотиков. Исследование механизмов синтеза феназинов бактерий P. aurantiaca В-162 проводили на уровне ключевых ферментов щикиматного пути – ДАГФ-синтазы, фосфоенопируват-синтазы (ФЕПсинтазы), трансальдолазы, а также антранилат-синтазы – основного фермента пути синтеза триптофана – предшественника пирролнитрина. Установлено, что ДАГФ-синтаза изучаемых бактерий представлена двумя изоферментами (ДАГФ-синтазой [phe] и ДАГФсинтазой [tyr]), которые подверженны ретроингибированию фенилаланином и тирозином .

Кроме того, активность ДАГФ-синтазы ингибируется феназином, действие которого носит бесконкурентный характер, и стимулируется ионами металлов, наиболее активными среди которых являются ионы Со2+, Сu2+ и Fe2+ [88, 90, 91]. Синтез ДАГФ-синтазы у бактерий P. aurantiaca B-162 осуществляется конститутивно [91]. На активность ФЕПсинтазы оказывают стимулирующее действие ионы Mg2+, Fe2+ и Со2+, в то вр е как мя трансальдолаза с помощью ионов металлов не регулируется [90]. Антранилат-синтаза подвержена ретроингибированию триптофаном, что характерно для всех представителей рода Pseudomonas. Кроме того, установлено, что синтез антибиотиков феназинового ряда у бактерий P. aurantiaca B-162 контролируется QS-системой с участием позитивного регулятора метаболизма N-гексаноил-гомосерин лактона – компонента QS-системы, участвующей в регуляции синтеза антибиотиков феназинового ряда [88] .

Оптимизированы условия (температурный оптимум, pH среды, источник углерода, наличие ионов металлов) культивирования бактерий P. aurantiaca В-162, что позволило повысить их продуктивность в 1,3 раза в отношении антибиотиков феназинового ряда и 1,2 раза в отношении пирролнитрина [88] .

Создание штаммов-продуцентов феназиновых антибиотиков. Впервые с помощью НГ-мутагенеза и последующей селекции на устойчивость к токсическим аналогам метаболитов ароматических пути (азасерину, m-фтор-DL-фенилаланину и 6диазо-5-оксо-L-норлейцину и др.) получены мутанты P. aurantiaca B-162 – продуценты антибиотиков феназинового ряда, уровень синтеза которых у отдельных штаммов достиг 205 мг/л, что в 3 раза, выше, чем у бактерий дикого типа) [92-96]. В ходе последующего мутагенеза был получен штамм B-162/255, устойчивый к более высоким концентрациям m-фтор-DL-фенилаланина, уровень продукции феназинов у которого достиг 420-450 мг/л, что по чти в 7 р аз выше, чем у бактерий дикого типа и почти в 17 раз – чем у ранее описанных продуцетов P. fluorescens и P. chlororaphis .

Установлено, что в основе сверхсинтеза феназиновых антибиотиков у мутантных штаммов лежит дерегуляция ДАГФ-синтазы (снятие ингибирования фенилаланином, тирозином и феназином), либо сверхсинтез N-гексаноил-гомосерин лактона (в 2 и 2,3 раза выше для мутантов B-162/298 и B-162/255, соответственно, чем у исходного штамма) [88, 92-94, 96] .

Показано, что клетки штамма P. aurantiaca В-162, а также полученные на его основе аналогрезистентные регуляторные мутанты, способные к сверхсинтезу антибиотиков феназинового ряда, обладают повышенной в 1,3 раза антибактериальной и антифунгальной активностями в отношении фитопатогенных микроорганизмов в условиях как лабораторных, так и полевых экспериментов .

Известно, что синтез феназиновых антибиотиков у бактерий Pseudomonas может осуществляться только при культивировании их в полноценных питательных средах, обогащенных соевым экстрактом, пептоном, дрожжевым экстрактом и т.д. Для повышения биотехнологических характеристик штаммов-продуцентов феназинов нами были предприняты попытки получения мутантов P. aurantiaca, способных к синтезу антибиотиков в минимальных средах простого состава (например, среде М9, содержащей в качестве источнгика углерода и энергии глюкозу). В результате НГ-мутагенеза бактерий В-162/255 был выделен мутант В-162/17, клетки которого приобрели способность синтезировать феназины при культивировании в среде М9, при этом уровень их продукции достигал 210 мг/л, тогда как бактерии исходного штамма В-162/255 в этих условиях синтезировали только следовые количества антибиотиков. Одной из возможных причин приобретения нового свойства мутантом В-162/17 может быть инактивация гена rpeA, кодирующего синтез сенсорной киназы, явдяющейся регулятором переключения клеточного метаболизма на синтез вторичных метаболитов [97]. Синтез феназинов мутантными бактериями В-162/17, также как и в случае с пиовердином (см. рис. 7), запускается уже в логарифмической фазе роста и за первые сутки их продукция достигает 50 мг/л на минимальной среде, что примерно соспоставимо с уровнем синтеза феназинов у бактерий дикого типа на 5-е сутки культивирования на полноценных средах. Мутантные бактерии P. aurantiaca, способные к синтезу феназиновых антибиотиков, в том числе на минимальных средах, могут быть предложены для промышленного получения препаратов феназиновых антибиотиков, а продуцирующие их штаммы – в сельскохозяйственной биотехнологии .

Механизмы резистентности бактерий продуцентов феназинов P. aurantiaca к собственным антибиотикам. Высокая антимикробная активность феназиновых антибиотиков объясняется механизмом их действия. Обладая способностью легко вступать в окислительно-восстановительные реакции, присоединять электроны и превращаться в относительно стабильные анионы, феназины вызывают генерацию активных форм кислорода (О2.-, OH- и H2O2), которые обладают высокой реакционной способность и индуцируют окислительный стресс, сопровождающийся гибелью микроорганизмов (рис. 18) .

–  –  –

Рисунок 18 – Механизм антагонистической активности бактерий-продуцентов феназиновых антибиотиков. Рhz – феназиновые антибиотики; а – клетка-продуцент, б – клетка-мишень В свою очередь, клетки-продуценты проявляют устойчивость к собственным феназинам, однако механизм этого явления в настоящее время в деталях еще не изучен .

Продемонстрировано лишь, что в формировании устойчивости к феназинам у бактерий Bacillus sр. принимает участие ацил-СоА-синтетаза. Что касается бактерий Pseudomonas, то исследование устойчивости к окислительному стрессу, вызываемому собственными феназинами, у них до сих пор никем не проводилось .

Было сделано предположение, что этот феномен у штаммов-продуцентов феназинов P. aurantiaca связан с наличием мощной антиоксидантной системы, которая способна индуцироваться в присутствии активных форм кислорода, эффективно подавлять развитие окислительного стресса и обеспечивать не только нормальную выживаемость бактерий-продуцентов в этих условиях, но также и сверхсинтез антибиотиков. С использованием двух мутантных штаммов P. aurantiaca – продуцентов феназиновых антибиотиков (уровень синтеза 210 и 410 мг/л соответственно), бактерий дикого типа (уровень продукции 71-76 мг/л) и непродуцирующих феназины phz–-мутантов )получены в результате Tn5-мутагенеза было изучено изменение активности отдельных составляющих антиоксидантного комплекса – каталазы, супероксиддисмутазы (СОД), глутатион-редуктазы, NADH-оксидазы, ключевого фермента клеточного метаболизма – ацил-СоА-синтетазы, а также изменение концентрации глутатиона (окисленной и восстановленной формы). Представленные на рис. 19 результаты свидетельствуют о том, что высокий уровень синтеза феназинов у штаммов–продуцентов P. aurantiaca кореллирует с возрастанием активности отдельных компонентов антиоксидантного комплекса. Наибольший вклад в этот процесс вносит каталаза, индукция синтеза которой возрастает в 16,4 раза и находится в прямой зависимости от уровня синтеза феназиновых антибиотиков. Аналогичная ситуация характерна и для суммарной концентрации глутатиона. Вместе с тем, установлено, что NADH-оксидаза у изучаемых

–  –  –

бактерий P. aurantiaca не участвует в ответной реакции клеток на окислительный стресс .

Интересно отметить, что для СОД и глутатион-редуктазы зарегистрирован взаимный компенсаторный эффект. В частности, для штамма В-162/55 при увеличении активности СОД уровень синтеза гултатион-редуктазы снижается, тогда как для штамма В-162/255, наоборот, активность СОД снижается, а глутатион-реддуктазы повышается .

–  –  –

Биотехнологическое использование штаммов Р. aurantiaca. Проведенные в лабораторных условиях исследования антагонистической активности P. aurantiaca B-162 показали, что изучаемые бактерии подавляют как вегетативную, так и генеративную функции фитопатогенных грибов (рис. 20)., относящихся к родам Fusarium, Alternaria, Ascochyta, Sclerotinia, Botrytis, Phytophthora, а также проявляют антибактериальную активность в отношении всех использованных в работе индикаторных культур (рис. 21) .

Ингибирование роста, %

Фитопатогенные грибы

Рисунок 20 – Антифунгальная активность бактерий P. aurantiaca B-162. Цифрами обозначены: 1 – A. alternata; 2 – Ascochyta sp.; 3 – B. cinerea; 4 – F. avenaceum 6(9);

5 – F. avenaceum 04-7; 6 – F. culmorum 1(8); 7 – F. culmorum 005; 8 – F. culmorum 1(17);

9 – F. oxysporum 6(14); 10 – F. oxysporum 6(12); 11 – F. sambucinum; 12 – F. semitectum;

13 – S. sclerotiorum, 14 – P. infestans 3/2; 15 – P. infestans 3/032; 16 – P. infestans 3/033 Диаметр зоны задержки

–  –  –

Рисунок 21 – Антибактериальная активность бактерий P. aurantiaca B-162. Цифрами обозначены: 1 – E. aroideae 291-1; 2 – E. aroideae 348-1; 3 – E. carotovora 75-V;

4 – E. carotovora 330; 5 – E. carotovora 8526; 6 – E. carotovora 549; 7 – E. carotovora С366;

8 – E. carotovora g217; 9 – P. atrofaciens 7967; 10 – P. glycinea 8541; 11 – P. lachrymans П-3, 12 – P. lachrymans 7595; 13 – P. lupini 8532; 14 – P. pisi 7152; 15 – P. syringae 345;

16 – P. syringae S-10; 17 – P. vignae 1025; 18 – P. xanthochlora 3416 На примере штамма-продуцента феназиновых антибиотиков P. aurantiaca Визучена антимикробная активность бактерий в системе in planta. Растения высаживали в инфицированную фитопатогенными грибами (F. avenaceum, Ascochyta sp. и B. cinerea) почву и обрабатывали бактериальной культурой P. aurantiaca В-162 (контроль) и P. aurantiaca В-162/498. Признаки заболевания растений возникали только на необработанных бактериями-антагонистами растениях на 20-е сут и к окончанию эксперимента (на 60-е сут) на листьях появлялись пятна и налет, а также регистрировалось пожелтение и увядание растений, в то время как в контрольных экспериментах, когда в почву вносили бактерии-антагонисты, растения оставались здоровыми (рис. 22) и отличались более развитой надземной частью (рис. 23) и корневой системой (рис. 24). При этом защитное действие бактерий мутантного штамма В-162/498 было более выраженным, чем в случае использования бактерий дикого типа. Подобный эффект зарегистрирован также в отношении к растений пшеницы (табл. 5) .

Рисунок 22 – Антифунгальная активность бактерий P. aurantiaca В-162/498 в системе in planta на примере растений огурца, культивируемых на почве, инфицированной Ascochyta sp. 1- после обработки культурой P. aurantiaca В-162/498, 2 и 3 – без обработки В производственных условиях установлено, что обработка растений томата бактериальной культурой P. aurantiaca В-162 (суспензия клеток в концентрации 105 КОЕ/ мл) приводила к подавлению развития грибов рода Botrytis, являющихся возбудителем серой гнили. Эффективность действия составила 92,3% (в качестве контроля применялась используемая в сельском хозяйстве бордосская жидкость) .

Совокупность полезных свойств мутантного штамма P. aurantiaca В-162/498 явилась основой для создания полифункционального биопестицидного препарата «Аурин», предназначенного для защиты растений от заболеваний бактериальной и грибной этиологии, а также стимуляции их роста [98, 99]. На препарат «Аурин»

разработаны «Техничиские условия» для производства препарата на РУП «Новополоцкий завод БВК» .

–  –  –

Рисунок 23 – Антифугнальная активность бактерий P. aurantiaca В-162 и P. aurantiaca Вна длину проростков растений огурца, культивируемых на почве, инфицированной F. avenaceum (А), Ascochyta sp.(Б) и B. cinerea (В) А Б Рисунок 24 – Стимуляция корнеобразования бактериями P. aurantiaca В-162 (А) по сравнению с контролем (Б - без обработки) у растений томата, культивируемых в почве

–  –  –

12,92±0,28 8,52±0,11 16,42±0,75 18,90±0,60 18,09±0,87 Стимулирующие рост растений метаболиты бактерий Pseudomonas Известно, что стимуляция роста растений ризосферными бактериями обусловлена синтезом индолилуксусной кислоты, гиббереллинов, цитокининов, витаминов;

улучшением фосфорного питания растений путем перевода фосфатов в растворимые соединения; фиксацией атмосферного азота; деструкцией растительного гормона старения

– этилена и индукцией устойчивости растений к абиотическим факторам [100] .

Гиббереллины. Синтезируемые бактериями фитогормоны регулируют многие процессы жизнедеятельности растений: прорастание семян, рост, дифференциацию тканей и органов, цветение, созревание плодов и т.д. Широкое применение нашли препараты, содержащие гиббереллины, которые используют для стимуляции прорастания семян и повышения их всхожести, усиления роста растения путем активации апикальных и интеркалярных (вставочных) меристем; индукции их раннего цветения и завязывания плодов [101]. Было установлено, что ростостимулирующая активность бактерии P .

aurantiaca связана с синтезом гиббереллинов [102]. В ходе исследований осуществлено выделение, идентификация и изучение биологической активности гиббереллинов, а также получение регуляторных мутантов, способных к их сверхпродукции и стимулирующей рост растений активности. В серии экспериментов было изучено влияние бактерий P .

aurantiaca В-162 на рост наиболее распространенных овощных культур. Установлено, что при обработке семян культурой бактерий P. aurantiaca В-162 наблюдается стимуляция роста побегов (в 1,4–2,2 раза) и корневой системы (в 1,7–3,3 раза) изучаемых сельскохозяйственных культур (рис. 25), что свидетельствует о высоком фитостимулирующем действии изучаемых бактерий .

Относительная масса, % побеги 150 корни Овощные культуры Рисунок 25 – Стимуляция роста побегов и корней овощных культур бактериями P. aurantiaca B-162. Цифрами обозначены: 1 – огурцы «Верасень», 2 – огурцы «Родничок», 3 – свекла «Красный шар», 4 – свекла «Бордо», 5 – томаты «Пралеска», 6 – томаты «Ляна», 7 – капуста «Белорусская 85», 8 – капуста «Русиновка», 9 – морковь «Нантская», 10 – морковь «Карлена», 11 – редис «Красный великан»

В ходе модельных экспериментов с использованием растений латука было установлено, что уровень синтеза гиббереллинов бактериями P. aurantiaca B-162 соответствует 13,18±0,34 мг/л, а результаты тонкослойной хроматографии позволили установить наличие 7 компонентов со значениями Rf, равными 0,02; 0,08; 0,25; 0,37; 0,51;

0,815 и 0,85. Проверка биологической активности компонентов показала, что наибольший стимулирующий эффект в отношении растений латука оказывает фракция со значением Rf, равным 0,02. Проведенный далее масс-спектрометрический анализ очищенного препарата этого компонента показал наличие ионов с максимумом поглощения (202 нм), временем удерживания (10,75 мин) и следующим соотношением масса/заряд (m/z): 329 ([М–Н2О]+), 347 ([М+H]+), 364 ([М+ Н2О]+), 379 ([М+СН3ОН] +), что соответствует гибберелловой кислоте (ГК3) (рис. 26) .

–  –  –

Создание штаммов-продуцентов гиббереллинов. Согласно литературным данным синтез гиббереллинов у растений и низших грибов подвержен ингибированию соединениями, являющимися ретардантами роста растений: CCC (2-хлорэтил)триметил аммоний хлорид), АМО-1618 (2-изопропил-4-диметиламин-5-метилфенил-1-пипередин карбоксилат метилхлорид), анцимидол ( -циклопропил--(-метоксифенил)-5-пиримидин метил этанол), Alar (сукцинат-2,2-диметилгидразид), Polaris (N,N-бис(фосфонометид)глицин) и т.д. [102]. Было сделано предположение, что использование токсических аналогов гормонов роста растений в качестве селектирующих факторов позволит отобрать мутантные штаммы бактерий, способных к сверхсинтезу гиббереллинов. В ходе НГмутагенеза и последующей селекции на устойчивость к ССС было получены мутанты, уровень продукции гиббереллинов у которых достигал 31 мг/л, что 2,3 раза больше, чем таковой у бактерий дикого типа и 15 раз выше, чем у известных в этом отношении ризосферных бактерий Pseudomonas. Продукция гиббереллинов у мутантых бактерий коррелировала с их ростостимулирующей активностью. Например, обработка семян латука клетками штамма P. aurantiaca В-162 приводит к увеличению длины гипокотилей в 1,9 раза по сравнению с контролем (вода), а клетками штамма G-50 (уровень синтеза гиббереллинов в 2,3 раза выше, чем у В-162) – в 3,37 раза. При обработке семян овощных культур (огурцы, томаты, капуст) наблюдалось увеличение длины гипокотилей в 1,6-1,9, а масса проростков – в 1,3-1,6 раз (табл. 6), тогда как при обработке семян технических культур данные параметры увеличивались в 1,9-2,1 и 1,7-1,8 раз соответственно (табл. 7). Ранее специфичность действия гиббереллинов в отношении стимуляции роста различных видов растений отмечали и другие авторы .

–  –  –

Таким образом, осуществлено выделение и идентификация гиббереллинов, синтезируемых бактериями P. aurantiaca B-162; впервые предложен метод отбора мутантов, способных к сверхсинтезу гиббереллинов путем использования в качестве селектирующего фактора токсических аналогов фитогормона, в частности, (2хлорэтил)триметил аммоний хлорида (ССС). На основе бактерий P. aurantiaca получены мутанты, синтезирующие до 31 мг/л гиббереллинов, что в 2,3 раза выше, чем продуктивность исходного штамма. Показано, что степень стимулирующего рост растений действия зависит от уровня синтеза гиббереллинов мутантными штаммами .

Индолил-3-уксусная кислота. В ходе изучения пути синтеза индолил-3-уксусной кислоты (ИУК) и механизмов ее генетической и биохимической регуляции у ризосферных бактерий P. mendocina установлено, что синтез этого гормона у них происходит с участием ИПВК-пути, в котором задействовано три фермента – триптофанаминотрансфераза, индолпируват-декарбоксилаза и индолацетальдегид-дегидрогеназа [103] .

Показано, что регуляция шикиматного пути у изучаемых бактерий осуществляется на уровне ключевого фермента ДАГФ-синтазы с помощью ретроингибирования двумя аминокислотами – тирозином и триптофаном. Репрессия синтеза данного фермента у бактерий P. mendocina не зарегистрирована. Синтез триптофана контролируется с помощью репрессии trpE-, trpD- и trpC-генов триптофаном, а также путем ретроингибирования антранилат-синтазы этой же аминокислотой. Синтез триптофанаминотрансферазы и индолпируват-декарбоксилазы (ИПВК), наоборот, индуцируется триптофаном. Синтез триптофанамин-аминотрансферазы, кроме того, репрессируется антранилатом [103, 104] .

С помощью НГ-мутагенеза и последующей селекции клонов на устойчивость к токсическому аналогу триптофана – 5-фтор-DL-триптофану получены регуляторные мутанты, способные к сверхсинтезу ИУК. Продукция гормона у мутантного штамма P .

mendocina 9-40 была в 10 раз выше, чем у дикого типа [103, 105]. Сверхсинтез ИУК коррелировал с возрастанием уровня синтеза ключевых ферментов ароматического пути

– ДАГФ-синтазы и триптофан-синтазы в 2 раза, триптофан-аминотрансферазы и индолилпируват-декарбоксилазы – примерно в 8 раз и 80 раз, соответственно (табл. 8) .

Кроме того, при обработке растений изучаемыми бактериями в экспериментах in vitro наблюдалась значительная стимуляция их роста (рис. 27 и 28) .

Конструирование штамма-продуцента ИПВК. С целью создания генноинженерного штамма – продуцента ИУК на основе бактерий P. mendocina было осуществлено клонирование ipdС-гена (кодирует синтез фермента индолилпируватдекарбоксилазы) с использованием векторов pUC18 и pXcmKn12 в клетках штамма E. coli

DH5. Для ПЦР применяли следующие праймеры:

прямой – 5’ GCTCCTAGGGTAGTGGAGTTAGTTGCTCG 3’;

обратный 5’ CTGGGGATCCGACAAGTAATCAGGC 3’ .

–  –  –

Рисунок 27 – Стимуляция роста проростков рапса под действием препарата мутантных бактерий P. mendocina 9-40 (7-е сутки). Концентрация клеток 1 х 107 кл/мл .

К 1- контроль без обработки, 2 - после обработки

–  –  –

В результате была получена гибридная плазмида pTVN4 (4,5 т.п.н.) со вставкой ipdСгена, размер которого – 1,7 т.п.н. (рис. 29). Наличие вставки ipdС-гена в гибридной плазмиде доказано с помощью повторной ПЦР, приобретению у рекомбинантными клетками E. сoli способности синтезировать ИУК, а также по появлению у них ИПВКдекарбоксилазной активности. Удельная активность индолпируват-декарбоксилазы у бактерий E. coli DH5, несущих клонированный ipdС-ген в составе гибридной плазмиды, составила 37±5,0 мкмоль/мин ·мг белка, тогда как у бесплазмидных вариантов 1,4±1,0 .

Нуклеотидная последовательность гена ipdC бактерий P. mendocina ВКМВ 1299 и соответствующая ей аминокислотная последовательность белка ИПВК-декарбрксилазы представлены на рис. 30. Ген ipdC кодирует белок с изоэлектрической точкой pI=10.18 массой 65,3 кДа, состоящий из 587 аминокислотных остатков. Аминокислотная последовательность ИПВКД содержит значительное количество серина (11,1%). Процент содержания гидрофобных аминокилотных остатков составляет 32 % .

Для изучения экспрессии ipdС-гена в бактериях P. mendocina сконструирована плазмида pAYSCD1.7 (рис. 31), стабильно наследующаяся в клетках этих бактерий .

Наличие pTVN4

4.5 т.п.н .

–  –  –

Рисунок 31 – Схема переклонирования гена ipdС из плазмиды pTVN4 в вектор pAYC31 плазмиды со встроенным ipdС-геном обеспечивает им повышенный уровень синтеза ИПВК-декарбоксилазы (в 5,3 раза) и ИУК, соответственно. Таким образом, регуляторный мутант P. mendocina 9-40 и рекомбинантный штамм, несущий плазмиду pAYC1.7 со встроенным ipdc-геном, могут быть рекомендованы для практического использования .

АЦК-дезаминаза бактерий P. mendocina ВКМВ 1299 .

Растительный гормон этилен является сигнальной молекулой, контролирующей многие физиологические процессы у растений, включая их прорастание, развитие цветков, созревание плодов, а также реакцию на действие факторов окружающей среды [106]. Образование этилена индуцируется различными биотическими (вирусные и бактериальные инфекции) и абиотическими (засуха, загрязнения почвы) факторами Резко усиливается выработка этилена в растительных тканях при механических повреждениях тканей .

Многие подходы, используемые для повышения урожайности сельскохозяйственных растений, направлены на снижение количества этилена, синтезируемого растением. Было установлено, что ризосферные бактерии PGPR-группы, стимулирующие рост растений, синтезируют фермент, способный регулировать уровень этилена в растениях. Этот фермент, 1-аминоциклопропан-1-карбоксилат-дезаминаза (АЦК-дезаминаза), гидролизует 1-аминоциклопропан-1-карбоксилат – непосредственный предшественник этилена, синтезируемый в тканях самого растения. Об эффективности действия АЦК-дезаминазы свидетельствует тот факт, что бактерии, синтезирующие этот фермент, способствуют удлинению корней растений, стимуляции их роста, а также повышению их урожайности в целом. Для разработки подходов повышения уровня синтеза АЦК-дезаминазы клетками P. mendocina было осуществлено клонирование гена acdS-гена этих в составе вектора

pXcmKn12. Для амплификации acdS гена использовались вырожденные праймеры:

(прямой): 5`-MGVAAGCTGGAATAYMTBRT-3`;

(обратный): 5`-ATCATVCCVTGCATBGAYTT-3` .

В качестве ДНК-матрицы использовали хромосомную ДНК бактерий P. mendocina

1299. Продукт ПЦР (рис. 31) использовали для последующего лигирования с вектором pXcmKn12. Полученная плазмида была названа pTM10 (рис. 32) .

–  –  –

Рисунок 31 – Электрофоретический анализ продуктов ПЦР в 0,7% агарозном геле: указан фрагмент размером ~ 1200 п.н. Дорожка 1 – подвижность продукта ПЦР гена acdS бактерий P. putida М, дорожка 2– подвижность ДНК-маркера «1 kb» производства Fermentas .

Фрагмент ДНК, несущий ген acdS, был переклонирован по Bam HI-сайту в вектор pAYS31. Полученная плазмида была названа pACD (рис. 33). Затем было осуществлено ее введение в клетки штамма P. mendocina 9-40, который был использован в дальнейшей работе для изучения влияния бактериальной АЦК-дезаминазы на солеустойчивость растений томатов .

Рисунок 32 – Карта плазмиды pTM10 Рисунок 33 – Карта плазмиды pACD. Указан встроенный фрагмент ДНК, несущий ген acdS бактерий P. mendocina Индукция устойчивости у растений к абиотическим факторам продуцирующими АЦК-дезаминазу рекомбинантными бактериями P. mendocina 9-40 (рАСD). Известно, что избыток хлорида натрия в почве подавляет рост и развитие растений. Действительно, как видно из результатов табл. 9, раствор NaCl, взятый в концентрациях 172 ммоль/л и 207 ммоль/л, вызывает уменьшение длины стебля и корней томатов, а также их биомассы. Однако при внесении в почву дополнительно суспензии бактерий P. mendocina 9-40 (рАСD) степень подавления роста и развития растений снижалась (особенно заметным был эффект при более высокой концентрации NaCl (207 ммоль/л) .

–  –  –

Высокий защитный эффект АЦК-дезаминазы бактерий P. mendocina 9-40 (рАСD) наблюдался при выращивании растений в присутствии солей тяжелых металлов меди и хрома. Обработанные культурой P. mendocina 9-40 (рАСD) растения имели в 2-3 раза большую длину стебля и корня по сравнению с контрольными и в 4 раза большую биомассу (табл. 10, рис. 34) .

–  –  –

** В ходе выполнения исследований расшифрованы механизмы регуляции ароматического метаболизма у метилотрофных бактерий (генетический контроль экспрессии генов с помощью репрессии и индукции, а так же ретроингибирование) на уровне ключевого фермента ароматического пути – ДАГФ-синтазы, и индивидуальных путей синтеза первичных метаболитов – аминокислот триптофана, фенилаланина и тирозина. Впервые установлено, что ароматический метаболизм метилотрофных бактерий имеет сходство с таковым у других известных в этом отношении бактерий, что подтверждает универсальный характер регуляторных процессов у микроорганизмов разного уровня филогенетического родства. Составлены интегральные схемы биосинтеза ароматических аминокислот, которые демонстрируют ключевые регуляторные звенья и возможные «рычаги» управления биосинтетическими процессами, что необходимо для разработки подходов направленной дерегуляции метаболизма при создании штаммовпродуцентов .

Получены новые данные о свойствах, биологической активности и механизмах синтеза вторичных метаболитов ароматической природы у важных в биотехнологическом отношении представителей Pseudomonas различных физиологических групп – флуоресцирующего пигмента пиовердина Рм (P. putida), антибиотиков ароматической природы – феназинов и пирролнитрина (P. aurantiaca), стимуляторов роста и развития растений – гиббереллинов (P. aurantiaca), ИУК и АЦК-дезаминазы (P. mendocina) .

Наряду с известными физико-химическими свойствами и биологической активностью впервые у пиовердина Рм обнаружена антирадикальная активность, сопоставимая с таковой известных флавоноидов – кверцитина, морина и рутина .

Установлено, что пиовердин Рм не обладает цитотоксичностью, а его выраженная антимикробная активность связана со способностью хелатировать ионы железа и переводить их в недоступную для других организмов форму, в результате чего рост и развитие последних задерживается. Изучены пути и механизмы регуляции синтеза пиовердина Рм. Установлено, что биосинтетическими предшественниками диоксихинолинового ядра пигмента являются L-фенилаланин и дигидрооротат, а пептидная часть представлена пятью аминокислотами – треонином, серином, лизином, аспарагиновой кислотой и N-оксиорнитином в молярном соотношении 3 : 2 : 1 : 1 : 1. По аминокислотному составу пиовердин Рм является уникальным и отличается от пигментов, синтезируемых известными представителями Pseudomonas. Детальный анализ механизмов синтеза пиовердина позволил создать общую схему его биогенеза. Выраженная антимикробная и немацидная активности продуцирующего пиовердин Рм штамма P .

putida М была положена в основу создания на его основе биологического препарата Немацид, который в настоящее время внедрен в производство на территории Республики Беларусь .

Охарактеризована антимикробная активность ризосферных бактерий P. aurantiaca Вявляющихся природными продуцентами феназиновых антибиотиков и пирролнитрина. Впервые продемонстрировано, что синтез феназинов регулируется на уровне ключевых ферментов ароматического пути ДАГФ-синтазы и ФЕП-синтазы, а пирролнитрина, кроме того, антранилат-синтазы путем ингибирования; в регуляции активности указанных ферментов значительную роль играют ионы металлов. Показано, что в регуляции синтеза феназиновых антибиотиков участвует QS-система, основным компонентом которой у бактерий P. aurantiaca В-162 является N-гексаноил-гомосерин лактон. Изучены механизмы устойчивости штаммов-продуцентов феназинов к собственным антибиотикам. Установлено, что высокий уровень их синтеза коррелирует с возрастанием активности отдельных компонентов антиоксидантного комплекса – каталазы, СОД, а также глутатиона. Показано, NADH-оксидаза не участвует в обеспечении устойчивости клеток у феназинам. Для СОД и глутатион-редуктазы зарегистрирован взаимный компенсаторный эффект – при увеличении уровня активности СОД уровень синтеза глутатион-редуктазы, наоборот, снижается .

Исследование механизмов стимулирующей рост растений активности ризосферных бактерий Pseudomonas показало, что этот феномен у бактерий P. aurantiaca связан со способностью к синтезу гиббереллинов, а у P. mendocina – ИУК и АЦК-дезаминазы .

Осуществлено выделение и идентификация гиббереллинов P. aurantiaca, показано, что основная роль в проявлении их фитостимулирующей активности принадлежит главному компоненту гиббереллинового комплекса – гибберелловой кислоте (ГК). Продукционная способность ГК достигает у бактерий P. aurantiaca 13,2 мг/л, что превышает таковой других известных в этом отношении штаммов. В ходе изучения пути синтеза ИУК и механизмов ее регуляции у бактерий P. mendocina установлено, что синтез этого гормона происходит с участием ИПВК-пути, в котором задействовано три фермента – триптофанаминотрансфераза, индолпируват-декарбоксилаза и индолацетальдегид-дегидрогеназа .

Показано, что регуляция шикиматного пути у изучаемых бактерий осуществляется на уровне ключевого фермента ДАГФ-синтазы с помощью единственного механизма – ретроингибирования двумя аминокислотами – тирозином и триптофаном. Синтез триптофана – предшественника ИУК, контролируется с путем репрессии trpE-, trpD- и trpC-генов и ретроингибирования антранилат-синтазы триптофаном. Наоборот, синтез ферментов ИПВК-пути – триптофан-аминотрансферазы и индолпируват-декарбоксилазы индуцируется этой аминокислотой. Продемонстрирована роль фермента АЦК-дезаминазы в проявлении стимулирующей рост растений активности бактерий P. mendocina, а также обеспечении ими высокого уровня устойчивости ряда с/х культур к загрязнению почвы хлоридом натрия и тяжелыми металлами .

Впервые разработаны новые подходы получения штаммов Pseudomonas – сверхпродуцентов вторичных метаболитов, основанные на использовании в качестве селектирующих агентов для отбора мутантов токсических аналогов метаболитов ароматического пути .

Получены мутанты P. putida М с повышенным в 1,6-2,5 раза уровнем синтеза пиовердина Рм, а также способные к его продукции в присутствии ионов железа .

Установлено, что пиовердины, синтезируемые штаммами-продуцентами, характеризуются измененным аминокислотным составом пептидной части молекулы пигментов. Это, в свою очередь, приводит к изменению спектра антимикробной активности «мутантных»

пиовердинов. Впервые клонирован и секвенирован ген pfrI бактерий P. putida М, кодирующий ECF 70-фактор, контролирующий синтез пиовердинов .

С помощью токсических аналогов ароматических аминокислот азасерина, m-фторDL-фенилалаинина и 6-диазо-5-оксо-L-норлейцина на основе штамма P. aurantiaca В-162 получены продуценты антибиотиков феназинового ряда, уровень синтеза которых достигает 405 мг/л, что почти в 7 раза выше, чем продуктивность исходного штамма .

Изучены механизмы сверхсинтеза феназиновых антибиотиков. Установлено, что в основе этого явления лежит дерегуляция ДАГФ-синтазы (у большинства из них зарегистрировано снятие ингибирования активности фермента фенилаланином, тирозином, либо феназином), а также повышение уровня синтеза N-гексаноил-гомосерин лактона. С использованием разработанного приема создан уникальный штамм-продуцент феназинов, клетки которого приобрели способность к сверхсинтезу антибиотиков на минимальных средах, при этом их продукция регистрируется на более ранних этапах роста культуры .

Один из штаммов-продуцентов – P. aurantiaca В-162/498 использован для получения нового полифункционального биопестицидного препарата «Аурин», предназначенного для защиты сельскохозяйственных культур от заболеваний грибной и бактериальной этиологии и стимуляции их роста. Препарат «Аурин» внедрен в производство на территории Республики Беларусь .

Впервые предложен метод получения и отбора мутантов, способных к сверхсинтезу гиббереллинов, путем использования в качестве селектирующего фактора токсических аналогов фитогормона, в частности, (2-хлорэтил)триметил аммоний хлорида .

На основе бактерий P. aurantiaca получены перспективные мутанты, синтезирующие до 31 мг/л гиббереллинов, что в 2,3 раза выше, чем продуктивность исходного штамма .

Показано, что степень стимулирующего рост растений действия зависит от уровня синтеза бактериями гиббереллинов .

С помощью мутагенеза и последующей селекции на устойчивость к токсическому аналогу триптофана – 5-фтор-DL-триптофану получены мутанты P. mendocina, способные к сверхсинтезу ИУК – в 10 раз выше, чем у исходного штамма. Установлено, что в основе сверхсинтеза бактериального ауксина лежит увеличение в 2 раза уровня синтеза ключевых ферментов ароматического пути – ДАГФ-синтазы и триптофан-синтазы, а ферментов специфического ИУК-пути – триптофан-аминотрансферазы и индолилпируватдекарбоксилазы – в 8 раз и 80 раз, соответственно. Под действием мутантных бактерий зарегистрирована значительная стимуляция роста с/х культур .

Осуществлено генно-инженерное конструирование штаммов-продуцентов ИПВК – фермента, участвующего в синтрезе ИУК, и АЦК-дезаминазы – разлагающего растительный «стрессовый» этилен (P .

mendocina). Клонирование генов ipdС и acdS в составе плазмид pAYSCD1.7 и pAYS31 и последующий перенос их в клетки P. mendocina обеспечил последним повышенный уровень синтеза ИПВК-декарбоксилазы (в 5,3 раза) и ИУК, соответственно, а также чрезвычайно высокий уровень защиты растительных культур от токсического действия тяжелых металлов. Полученные генно-инженерные штаммы P. mendocina могут быть рекомендованы для практического использования .

Список литературы

1. Гриц, Н.В. Антибиотикорезистентность бактерий рода Pseudomonas, выделенных из природных источников / Н.В. Гриц., Н.П. Максимова, Ю.К. Фомичев // Вест. Белорус .

ун-та. Сер. 2: Химия. Биология. География. – 1981. – № 2. – С.27-30 .

2. Максимова, Н.П. Получение протопластоподобных структур P.putida и их реверсия в бактериальные формы /Н.П. Максимова, Р.А. Желдакова, Ю.К. Фомичев // Микробиология. - 1982. – Т.51. – №4. – С.628-632 .

3. Фомичев, Ю.К. Слияние протопластов – метод конструирования гибридных бактериальных штаммов / Ю.К. Фомичев, Н.П. Максимова, Р.А. Желдакова // Генетика. –1982. – №12. – С.1927-1937 .

4. Желдакова, Р.А. Особенности процессов формирования и реверсии сферопластов грамотрицательных бактерий: дис…. канд. биологич. наук: 03.00.07 / Р.А. Желдакова .

–Минск, 1990. – С.112 .

5. Максимова, Н.П. Плазмидный контроль синтеза бактериоцинов у бактерий рода Pseudomonas / Н.П. Максимова, И.Н. Семенова, А.М. Кульба, Ю.К. Фомичев // Молекул. генет., микробиол., вирусол. – 1983. – №2. – С.29-32 .

6. Максимова, Н.П. Конъюгативная плазмида рМК5, контролирующая признак бактериоциногенности Pseudomonas sp. СMК 72 / Н.П. Максимова, Р.А. Желдакова, А.М. Кульба, Ю.К. Фомичев // Молекул. генет., микробиол., вирусол. – 1985. – №1. – С.22-25 .

7. Желдакова, Р.А. Конъюгативная R-плазмида факультативных метилотрофных бактерий Pseudomonas sp. M / Р.А. Желдакова, Н.П. Максимова, А.М. Кульба, Ю.К. Фомичев // Молекул. генет., микробиол., вирусол. – 1985. – №1. – С.25-28 .

8. Максимова, Н.П. Видовая идентификация метанолутилизирующих бактерий Pseudomonas sp.M / Н.П. Максимова // Вестн. Белорус. ун-та. Сер. 2: Химия. Биология .

География. Минск, 1991. – № 3. С.40-45 .

9. Maximova, N.P. Characterization of fluorescent pigment of new plant growth stimulating bacteria Pseudomonas putida M / N.P. Maximova, O.V. Blagevich, Yu. K. Fomichev // International conference on plant pathogenic bacteria: Abs. section P5/A2, Paris, June 9-12, 1992 / Paris, 1992. P.45 .

10. Maximova N.P., Characterization of Flu--mutants of plant-growth-stimulating bacteria Pseudomonas putida M / N.P. Maximova, V.V. Lysak, O.K. Ignatovich / International conference on plant pathogenic bacteria: Abs. section P5/A2, Paris, June 9-12, 1992. / Paris,

1992. P.183-184 .

11. Блажевич, О.В.Генетические и биохимические аспекты биосинтеза флуоресцирующего пигмента пиовердина Рм ризосферными бактериями Pseudomonas putida M / О.В. Блажевич, Н.П. Максимова, В.В. Лысак // Достижения современной биологии и биологическое образование: Тр. науч. конф., посвященной 75-летию биологического факультета Белгосуниверситета / Бел. гос. ун-т. Минск, 1997. С.95 – 100 .

12.Лысак, В.В. Теоретические и прикладные аспекты создания биопрепаратов для защиты растений / В.В. Лысак, Н.П. Максимова // Вест. Белорус. ун-та. Сер. 2: Химия .

Биология. География. – 2001. – № 3. – С.56-64 .

13. Блажевич, О.В. Характеристика флуоресцирующего пигмента пиовердина РМ бактерий Pseudomonas putida: Дис… канд. биол. наук: 03.00.07/ О.В. Блажевич, – Минск, 1994. – С.157 .

14. Максимова, Н.П. Метаболизм ароматических соединений у метилотрофных бактерий:

Дис. доктора биол. наук: 03.00.07 и 03.00.23 / Н.П. Максимова, – Минск, 2005. – С.351 .

15. Титок, М.А. R-плазмиды факультативных метилотрофных Pseudomonas :

характеристика плазмиды рМ3 / М.А Титок., В.В. Лысак, А.М. Кульба // Вест. Белорус .

ун-та. Сер.2: Химия. Биология. География. – 1989. – №2. – С.42-46 .

16. Титок, М.А. Характеристика R-плазмиды рМ3 (Inc P-9) широкого круга хозяев / М.А .

Титок, Н.П. Максимова, Ю.К. Фомичев // Молекул. генет., микробиол. и вирусол. – 1991. – № 9. – С.9-13 .

17. А.с. 1599434 СССР, МКИ4 С 12 Р 13/22. Плазмидная ДНК pMTF59, предназначеная для транпозонного мутагенеза бактерий семейства Enterobacteriaceae / М.А. Титок, Н.П. Максимова, В.А. Прокулевич, Ю.К. Фомичев (СССР). – № 4477293/31-13;

Заявлено 02.11.87; Опубл.15.11.90, Бюл. № 8 // Открытия. Изобретения. – 1990. – № 8 .

– C.12

18. Титок, М.А.. Использование плазмиды рМ3 Pseudomonas sp. M для транспозонного мутагенеза бактерий семейства Erwinia / М.А. Титок, В.А. Прокулевич, Н.П .

Максимова, Ю.К. Фомичев // Молекул. генет., микробиол. и вирусол. – 1989 - № 11. – С.45-48 .

19. Титок, М.А. Характеристика R-плазмиды рМ3 (IncP9-группы) метилотрофных Pseudomonas: Дис... канд. биол. наук: 03.00.07 / Титок М.А.– Минск, 1990. – С. 125 .

20. Титок, М.А. Клонирование rep-области плазмиды широкого круга хозяев рМ3 (IncP9)/ М.А Титок., И.Н. Олехнович, А.Н. Евтушенков // Молекул. генетика, микробиология и вирусология. – 1991. – №3. – С.18-23 .

21. Олехнович, И.Н. Клонирование генов 3-дезокси-D-арабиногептулозонат-7-фосфатсинтазы метилотрофных Pseudomonas в клетках Escherichia coli / И.Н Олехнович, Ю.К. Фомичев // Генетика. – 1990. – Т. 26, № 3. – С.418-423 .

22. Олехнович, И.Н. Клонирование генов биосинтеза триптофана Pseudomonas putida в клетках Escherichia coli / И.Н. Олехнович, Ю.К. Фомичёв // Генетика. – 1990. – Т. 26, № 10. – С.1713-1720 .

23. Greanted, A. The replication and stable-inheritance function of IncP-9 plasmid pM3 / A .

Greanted, M. Titok, R. Krasowiak et al. // Microbiology. – 2000. – Vol. 146, N 9. – P.2249Greated, A. The replication and stable-inheritance functions of IncP-9 plasmid рM3 / Greated, A., at all. // Microbiology. – 2000. – V. 146. – Р2249-2258 .

25. Василенко, С.Л. Создание системы генетического анализа бактерий Pseudomonas mendocina./ С.Л. Василенко, М.А. Титок, Н.П. Максимова // Генетика. – 2000. – Т. 36, № 1. – С.28-34 .

26. Василенко, С.Л. Оптимизация условий мутагенеза для бактерий Pseudomonas mendocina / С.Л. Василенко, М.А. Титок, Н.П. Максимова, // Вест. Белорус. ун-та. – Сер.2: Химия. Биология. География. – 2003. – № 1. – С. 43-47 .

27. Василенко, С.Л. Конъюгационное картирование бактерий Pseudomonas mendocina / С.Л. Василенко, М.А. Титок, Н.П. Максимова // Генетика. – 2003. – Т.39, №11. – С .

1445-1453 .

28. Построение генетической карты бактерий Pseudomonas mendocina / С.Л. Василенко, Н.П. Максимова, М.А. Титок // Генетика. – 2003. – Т.39, №11. – С. 1454-1460 .

29. Характеристика нового облигатного метилотрофа Methylobacillus М75 / Н.П .

Максимова, Доброжинецкая, Е.В. // Вестн. Белорус. ун-та. Сер. 2: Химия. Биология .

География. 1994. № 3. С. 32–36 .

30. Доброжинецкая, Е.В. Использование бактерий Methylobacillus mucogenes M75 для утилизации метанола / Е.В. Доброжинецкая, В.В. Щерба, Н.П. Максимова // Биотехнология. 1995. № 5-6. С. 30–31 .

31. Пат. 1973 BY, МПК С12 N1/20, C12 Q1/06. Штамм бактерий Methylobacillus sp. 75, используемый в качестве тест-культуры для определения метанола и метиламина / Максимова Н.П., Доброжинецкая Е.В., Фомичев Ю.К. № 1969; Заявлено 13.06.1994;

Опубл. 4.08.1997 //Афiцыйны бюлетэнь / Дзярж. пат. ведамства Рэсп. Беларусь .

1997. № 1. С. 3 .

32. Максимова, Н.П. Биосинтез биологически активных соединений ароматической природы микроорганизмами / Н.П. Максимова и [др.] // Выбраныя навуковыя працы Беларускага дзяржаўнага унiверсiтэта. Бiялогiя. Геаграфiя. / Адк. рэд. I. I. Пiрожнiк .

Мн.: БДУ, 2001.Т. 7. С. 102-126 .

33. Доброжинецкая, Е.В. Регуляция биосинтеза ароматических аминокислот у облигатных метилотрофных бактерий Methylobacillus mucogenes M75 / Е.В. Доброжинецкая // Дисс. канд. биол. наук: 03.00.07– Минск, 1995. – 88с .

34. Максимова, Н.П., Фомичев Ю.К. Регуляция активности и синтеза 3-дезокси-Dаробиногептулозонат-7-фосфат-синтазы у облигатного метилотрофа Methylobacillus flagellatum КТ / Н.П. Максимова, Ю.К. Фомичев // Молекул. генет., микробиол. и вирусол. 1991.– № 9. С. 6–9 .

35. А.с. 1206306 СССР, МКИ4 С12 Р13/22. Штамм Pseudomonas species M35 продуцент L-триптофана на этаноле / Н.П. Максимова, И.Н. Олехнович, Р.А. Желдакова, Ю.К .

Фомичев (СССР). № 3; Заявлено 06.07.84; Опубл. 23.01.86, Бюл. № 3 // Открыт ия .

Изобретения. 1986. № 3. C. 14 .

36. Олехнович, И.Н. Триптофановый оперон факультативных метилотрофных бактерий Pseudomonas sp. M. I. Выделение и характеристика ауксотрофных Trp—мутантов / И.Н .

Олехнович, Н.П. Максимова, Ю.К. Фомичев // Генетика.– 1985.– Т. 21, № 7.– С.1099– 1104 .

37. Максимова, Н.П. Триптофановый оперон факультативных метилотрофных бактерий Pseudomonas sp. M III. Характеристика регуляторных 5-МТR–мутантов / Н.П .

Максимова, И.Н. Олехнович, Ю.К. Фомичев // Генетика.– 1986. Т. 22, № 2.– С.194– 199 .

38. Олехнович, И.Н. Получение Tyr--мутантов факультативных метилотрофных бактерий Pseudomonas sp. M / И.Н. Олехнович, Н.П. Максимова, Ю.К. Фомичев // Генетика.– 1986.– Т. 22, № 4.– С.705–708 .

39. Блажевич, О.В. Биосинтез пиримидинов бактериями Pseudomonas putida M / О.В .

Блажевич, Н.П. Максимова // Вестн. Белорус. ун-та.– Сер. 2: Химия. Биология .

География. 1993.– № 2. С.21–26 .

40. Максимова, Н.П. Генетика и биохимия биосинтеза ароматических соединений метилотрофными микроорганизмами / Н.П. Максимова // Вестн. Белорус. ун-та. Сер. 2:

Химия. Биология. География. 1996. № 3. C.51–54 .

41. Доброжинецкая, Е.В. Регуляция биосинтеза триптофана у облигатного метилотрофа Methylobacillus mucogenes / Е.В. Доброжинецкая, Н.П. Максимова, Ю.К. Фомичев // Генетика. 1996. Т. 32, № 8. С.1056–1060 .

42. Максимова, Н.П. Регуляция биосинтеза ароматических аминокислот у облигатных метилотрофных бактерий M. mucogenes М75 / Н.П. Максимова, Е.В. Доброжинецкая, Ю.К. Фомичев // Изв. РАН. Сер. биол. наук. 2000. № 4. С.428–437

43. А.с. 1191464 СССР, МКИ4 С12 Q1/04. Штамм Pseudomonas species M3 тест -объект для определения продукции L-триптофана / Н.П. Максимова, И.Н. Олехнович, Р.А .

Желдакова, Ю.К. Фомичев (СССР). № 42; Заявлено 25.05.84; Опубл. 15.11.85, Бюл. № 1 // Открытия. Изобретения. 1986. № 1. C. 12 .

44. А.с. 1254005 СССР, МКИ4 С12 Р13/22. Штамм Pseudomonas species M9 тест культура для определения L-фенилаланина / Н.П.Максимова, И.Н. Олехнович, Р.А. Желдакова, Ю.К. Фомичев (СССР). № 32; Заявлено 1.03.85; Опубл. 30.08.86, Бюл. № 12 // Открытия. Изобретения. 1986. № 12. C. 18 .

45. А.с. 1254006 СССР, МКИ4 С12 Р13/22. Штамм Pseudomonas species M7 тест культура для определения L-тирозина / И.Н. Олехнович, Н.П. Максимова, Ю.К. Фомичев (СССР).№ 32; Заявлено 03.01.85; Опубл. 30.08.86, Бюл. № 12 // Открытия .

Изобретения. 1986. № 12. C. 18 .

46. А.с. 1535893 СССР, МКИ4 С12 N15/00, 1/20, С12 Q1/00. Штамм бактерий Pseudomonas sp., используемый в качестве тест-культуры для определения никотиновой кислоты /Н.П.Максимова, И.Н. Олехнович, Ю.К. Фомичев (СССР).№ 4343600/31 -13; Заявлено 14.12.87; Опубл. 15.01.90, Бюл. № 2 // Открытия. Изобретения. 1990. № 2. C. 8 .

47. А.с. 1441923 СССР, МКИ4 С12 N9/88. Штамм Pseudomonas species продуцент триптофансинтазы / И.Н. Олехнович, Н.П. Максимова, Ю.К. Фомичев (СССР). № 4208726/31-13; Заявлено 10.03.87; Опубл. 30.11.88, Бюл. № 44 // Открытия .

Изобретения. 1988. № 44. C. 4 .

48. Олехнович, И.Н. Репрессия синтеза и ретроингибирование 3-дезокси-Dарабиногептулозонат-7-фосфат-синтазы факультативных метилотрофных бактерий Pseudomonas sp. М / И.Н. Олехнович, Н.П. Максимова, Ю.К. Фомичев. // Молекул .

генет., микробиол. и вирусол.– 1986, № 12.– С.34–36 .

49. Максимова, Н.П. Регуляция синтеза 3-дезокси-D-арабиногептулозонат-7-фосфатсинтазы у бактерий Pseudomonas / Н.П. Максимова, И.Н. Олехнович, Ю.К. Фомичев // Генетика.1991. Т.27, № 2. С.217–221 .

50. Олехнович, И.Н. Триптофановый оперон факультативных метилотрофных бактерий Pseudomonas sp. M. II. Регуляция синтеза триптофана / И.Н. Олехнович, Н.П .

Максимова, Ю.К. Фомичев // Генетика.– 1985.– Т. 21, № 10.– С.1627–1633 .

51. Максимова, Н.П. Регуляция биосинтеза ароматических аминокислот у метилотрофных бактерий / Н.П. Максимова, И.Н. Олехнович, Ю.К. Фомичев // Биохимия и физиология микроорганизмов: Сб. ст. Пущино: ОНТИ НЦБИ АН СССР, 1987.– С.77-85 .

52. А.с. 1255639 СССР, МКИ4 С12 11 9/00. Способ получения 5-фосфорибозилпирофосфат-синтазы / И.Н. Олехнович, Н.П. Максимова, Ю.К. Фомичев (СССР).-№ 33; Заявлено 28.01.85; Опубл. 07.09.86, Бюл. № 12 // Открытия .

Изобретения. 1986. № 12. C. 15 .

53. А.с. 1264705 СССР, МКИ4 С12 Р13/22. Способ определения 5-фосфорибозилпирофосфата / И.Н. Олехнович, Н.П. Максимова, Ю.К. Фомичев (СССР) .

Заявлено 22.01.85; Опубл. 15.06.86. C. 6 .

54. Максимова, Н.П. Регуляция биосинтеза фенилаланина у облигатного метилотрофа Methylobacillus М75 / Н.П. Максимова, Е.В. Доброжинецкая, Ю.К. Фомичев // Молекул. генет., микробиол. и вирусол.– 1990. № 10. С.28–30 .

55. Олехнович, И.Н. Регуляция биосинтеза фенилаланина и тирозина у факультативных метилотрофных Pseudomonas sp. M7 / И.Н. Олехнович, Н.П. Максимова, Ю.К .

Фомичев // Генетика. 1987. Т. 23, № 3. С.414–420 .

56. Олехнович, И.Н. Регуляция биосинтеза ароматических аминокислот у факультативных метилотрофных бактерий: Дис... канд. биол. наук: 03.00.15 / И.Н. Олехнович,– Минск, 1995 .

57. Пат. 4217416 США, МКИ2 С 12 Р 7/42. Микробиологический способ получение 2,3диоксибензойной кислоты / Заявл. 19.04.1979; Опубл. 12.08.1980; НКИ 436-180, Т. 997 .

– № 2. – С.23 .

58. А.с. 1621508 СССР, МКИ4 С 12 Р 13/22. Штамм бактерий Pseudomonas sp. M продуцент сидерофоров, подавляющих рост фитопатогенных бактерий / Н.П .

Максимова, В.В. Лысак, Ю.К. Фомичев (СССР). № 1969; Заявл ено 04.10.88; Опубл .

15.09.90. 7с .

59. Максимова, Н.П. Характеристика флуоресцирующего пигмента пиовердина Рм Pseudomonas putida M / Н.П. Максимова и [др.] // Микробиология. 1994. Т. 63. – №

5. С.1038-1044 .

60. Максимова, Н.П. Роль фенилаланина в биосинтезе флуоресцирующего пигмента у Pseudomonas putida / Максимова Н.П., Блажевич О.В., Фомичев Ю.К. // Микробиология. 1992. Т. 61, № 5. С.818–823 .

61. Блажевич, О.В. Биосинтез пиримидинов бактериями Pseudomonas putida M / О.В .

Блажевич, Н.П. Максимова // Вестн. Белорус. ун-та.– Сер. 2: Химия. Биология .

География. 1993.– № 2. С.21–26 .

62. Максимова, Н.П. Роль пиримидинов в биосинтезе флуоресцирующего пигмента пиовердина Рм у Pseudomonas putida M / Н.П. Максимова, О.В. Блажевич, Ю.К .

Фомичев // Молекул. генет., микробиол. и вирусол. 1993.– № 5. С.22–26 .

63. Блажевич, О.В. Биосинтез флуоресцирующего пигмента пиовердина Рm у ризосферных бактерий Pseudomonas putida M / О.В. Блажевич, Н.П. Максимова // Изв. РАН. Cер .

биол. наук. 1994. № 2. С.205–210 .

64. Кулешова, Ю.М. Определение антирадикальных свойств бактериального сидерофора пиовердина Pм / Ю.М. Кулешова, Н.П. Максимова, В.А. Костюк // Новости медикобиологических наук. – 2005. – №2. С.49–54 .

65. Кулешова, Ю.М. Характеристика антирадикальной активности бактериального пигмента пиовердина Pм / Ю.М. Кулешова, Н.П. Максимова // Вестн. Белорус. гос. унта. Сер. 2, Химия. Биология. География. – 2006. – № 1. – С.57–60 .

66. Кулешова, Ю.М. Идентификация и характеристика пиовердина Pм – нового антирадикального соединения, синтезируемого бактериями Pseudomonas putida КМБУ4308 / Кулешова Ю.М. и [др.] // Труды Белорусского государственного университета. – 2006. – Выпуск 1. С.89–97 .

67. Кулешова, Ю.М. Влияние ионов металлов на антирадикальные свойства бактериального сидерофора пиовердина Pм / Ю.М. Кулешова //Известия НАН Беларуси, Сер. Биол. наук. – 2006. – № 5. – С.113-115 .

68. Кулешова, Ю.М. Получение бактерий Pseudomonas putida КMБУ4308, способных к сверхпродукции пигмента пиовердина Рм / Ю.М. Кулешова, М.В. Камаева, Н.П .

Максимова // Вестн. Белорус. гос. ун-та. Сер. 2, Химия. Биология. География. – 2006. – № 2. – С.48–52 .

69. Максимова, Н.П. Генетические основы повышения продуктивности микроорганизмов и растений / Н.П. Максимова и [др.] // Вестн. Белорус. гос. ун-та. Сер. 2, Химия .

Биология. География. – 2006. – № 3. – С.54–60 .

70. Максимова, Н.П. Генетические подходы к созданию штаммов-продуцентов биологически активных соединений на основе ризосферных бактерий Pseudomonas / Н.П. Максимова и [др.] // «Молекулярная и прикладная генетика» /под редакцией академика Л.В. Хотылевой. – 2008 г. Минск. – Том 8. – С.143–151 .

71. Кулешова, Ю.М. Аминокислотный состав пиовердинов, синтезируемых мутантными бактериями Pseudomonas putida КМБУ 4308 с повышенным уровнем продукции пигмента / Ю.М. Кулешова, Е.О. Корик, Н.П. Максимова // Физиологические, биохимические и молекулярные основы функционирования биосистем: Труды Белорусского государственного университета. Т. 3., ч. 1 / под ред. В.М. Юрина.– Минск: 2008.– С.155–162 .

72. Lamont, I.L. Identification and characterization of novel pyoverdine synthesis genes in Pseudomonas aeruginosa / I.L. Lamont, L.W. Martin // Microbiology – 2003. – Vol. 149, № 4. – P.833–842 .

73. Poole, K., McKay G.A. Iron acquisition and its control in Pseudomonas aeruginosa / K Poole., G.A., McKay // Frontiers in Bioscience. – 2003. – Vol. 8, №1. – P.661–686 .

74. Weller, D. M. Pseudomonas biocontrol agents of soilborne pathogens: looking back over 30 years / D. M. Weller // Phytopathology – 2007. – Vol. 97, № 1. – P.250–256 .

75. Duijeff, B.J. Microbial antagonism at the root level is involved in the suppression of Fusarium vilt by the combination of non-pathogenic Fusarium oxysporum Fo47 and Pseudomonas putida WCS358 / B.J. Duijeff et all. // Phytopathology. – 1999. –V.89, №2. – P.1073–1079 .

76. Schalk, I. J. Metal trafficking via siderophores in Gram-negative bacteria: specificities and characteristics of the pyoverdine pathway / I. J Schalk // J. Inorg. Biochem. – 2008. – Vol .

102, №1. – P.1159–1169 .

77. Cipollone, R. Involvement of Pseudomonas aeruginosa rhodanese in protection from cyanide toxicity / R Cipollone et all // Appl. Environ. Microbiol. – 2007. – Vol. 73, № 2. – P.390– 398 .

78. Robin, A. Iron Dynamics in the Rhizosphere:Consequences for Plant Health and Nutrition / A Robin et all // Advances in Agronomy. – 2008. – Vol. 99, Chapter 4. – P.184–225 .

79. Lavicoli, A. Induced systemic resistance in Arabidopsis thaliana in response to root inoculation with Pseudomonas fluorescens CHA0 /. A Lavicoli, E Bouted., A Buchala., J.-P Metraux. // MPMI. – 2003. – Vol.16, № 10. – P.851–859 .

80. Rivaul, F. Synthesis of pyochelin–norfloxacin conjugates / F Rivaul et all// Bioorg. Med .

Chem. Lett. – 2007. – Vol.17, № 3. – P.640–644 .

81. Кулешова, Ю.М. Роль бактериального сидерофора пиовердина в антагонистической активности Pseudomonas putida / Ю.М. Кулешова, Н.П. Максимова, В.Д. Поликсенова // Вестн. Белорус. гос. ун-та. Сер. 2, Химия. Биология. География. – 2008. – № 3. – С.63–67 .

82. А.с. 1621508 СССР, МКИ4 С12 Р13/22. Штамм бактерий Pseudomonas sp. M продуцент сидерофоров, подавляющих рост фитопатогенных бактерий / Н.П .

Максимова, В.В. Лысак, Ю.К. Фомичев (СССР). Заявлено 04.10.88; Опубл. 15.09.90 .

C. 9 .

83. Комарова, М.С. Изучение возможностей использования бактериальных препаратов в борьбе с галловой нематодой в условиях защищенного грунта / М.С. Комарова, Н.П .

Максимова, И.А. Баева. // Защита растений. № 5. 2001. С.25 .

84. Khramtsova, E. Selection of the new pseudomonas strains for plants stimulating biopreparations creation / E. Khramtsova, I. Russkikh, N. Maximova // Abst. 17th International Conference on Plant Growth Substances, Brno, July 1-6, 2001 / Brno, 2001. Р .

283-284 .

85. Пат. 2051586, МКИ 6 А01 N 63/00, С12 N1/20, С12 R1:40. Штамм бактерий Pseudomonas putida биостимулятор роста растений / Н.П. Максимова, В.В. Лысак, О.В. Игнатович, Ю.К. Фомичев. № 2051586; Заявлено 12.07.91; Опубл. 10.01.96 // Изобретения.– 1996.– № 1.– С. 3 .

86. Феклистова, И.Н. Оптимизация условий синтеза феназина бактериями Pseudomonas

aurantiaca B-162 / И.Н. Феклистова, Н.П. Максимова // Вест. Белорус. ун-та.– Сер. 2:

Химия. Биология. География.– 2005.– № 3.– С.29-31 .

87. Феклистова, И.Н. Оптимизация условий синтеза феназина бактериями Pseudomonas aurantiaca B-162 / И.Н. Феклистова, Н.П. Максимова // Синтез феназиновых соединений бактериями Pseudomonas aurantiaca B-162 // Вест. Белорус. ун-та.– Сер. 2:

Химия. Биология. География.– 2005.– № 2.– С. 66-69

88. Феклистова И.Н. Синтез антибиотиков ароматической природы у бактерий Pseudomonas aurantiaca B-162:Дис... канд. биол. наук: 03.00.07 / И.Н. Феклистова – Минск, 2006. – С.158

89. Феклистова, И.Н. Синтез пирролнитрина бактериями Pseudomonas aurantiaca B-162 / И.Н. Феклистова, Н.П. Максимова // Физиологические, биохимические и молекулярные основы функционирования биосистем: Труды Белорусского государственного университета. Т. 3., ч. 1 / под ред. В.М. Юрина.– Минск: 2008.– С.148–155 .

90. Феклистова, И.Н. Влияние ионов металлов на активность ключевых ферментов ароматического пути у бактерий Pseudomonas aurantiaca B-162 / И.Н. Феклистова, Н.П. Максимова // Вест. Белорус. ун-та.– Сер. 2: Химия. Биология. География.– 2004.– № 3.– С.48–53 .

91. Феклистова, И.Н. ДАГФ-синтаза Pseudomonas aurantiaca B-162: регуляция активности и синтеза / И.Н. Феклистова, Н.П. Максимова // Молекул. генетика, микробиол. и вирусол. – 2005. – № 4. – С. 34-36 .

92. Феклистова, И.Н. Получение штаммов Pseudomonas aurantiaca, способных к сверхпродукции антибиотиков феназинового ряда / И.Н. Феклистова, Н.П. Максимова // Микробиология. – 2008. – Т. 77, № 2. – С.207-212 .

93. Feklistova, I.N. Obtaining Pseudomonas aurantiaca strains capable of overproduction of phenazine antibiotics / I.N. Feklistova, N.P. Maksimova // Microbiology. – 2008. – Vol. 77, № 2. – P.176-180 .

94. Максимова, Н.П. «Генетические подходы к созданию штаммов-продуцентов биологически активных соединений на основе ризосферных бактерий Pseudomonas. / Н.П. Максимова и [др.] // Сборник научных трудов «Молекулярная и прикладная генетика». – 2008. – Т.8. – С.143-151 .

95. Веремеенко, Е. Г. Получение и характеристика мутантов Pseudomonas – продуцентов антибиотиков феназинового ряда / Е.Г. Веремеенко, М.Н. Федорович, И.Н Феклистова, Н.П. Максимова // Вестн. Белорус. гос. ун-та. Сер. 2: Химия. Биология. География .

2009. № 1. – С.44-48 .

96. Феклистова, И.Н. Биотехнологические подходы к созданию продуцентов антибиотиков на основе ризосферных бактерий рода Pseudomonas / И.Н. Феклистова, Н.П. Максимова // Физиологические, биохимические и молекулярные основы функционирования биосистем: Труды Белорусского государственного университета / под ред. В.И. Юрина.– Минск: 2007.– С. 181–189 .

97. Cheryl, A Whistler. III. Repression of Phenazine Antibiotic Production in Psedomonas aureofaciens Strain 30-84 RpeA / A. Whistler Cheryl, S. Lenard // J. Bacteriol. – 2003. – Vol. 185, № 13. – P. 3718-3725 .

98. Prischepa, L. Bioproducts in the control of soil-borne pathogens under cover / L. Prischepa, D.Voitka, I. Feklistova. N. Maximova // Zeszyty problemowe Postpw Nauk Polniczych. – 2008. – Z. 529. – P.149–154 .

99. Feklistova, I.N. New method of extending the expiry date of biopesticides „nemacide“ and „aurine“ by using lignohumate / I.N. Feklistova, D.V.Maslak, N.P. Maksimova // World of Lignohumate. – 2009. – May-June. P.7-10 .

100. Vrany, J. Inoculation of plant growth, yields and physiological properties of tubers in potato and sugar-beet regions / J. Vrany, et al. // Folia Microbiol. – 1990. – Vol. 35, № 2. – P.326Lee, I.I. Effects of gibberellin biosynthesis inhibitors on native gibberellin content, growth and floral initiation in Sorghum bicolor / I.I Lee., K.R. Foster, P.W Morgan // J. Plant Growth Regul. – 1998. – Vol. 17. – P.185-195 .

102. Феклистова, И.Н. Характеристика гиббереллинов, синтезируемых бактериями Pseudomonas aurantiaca B-162 / И.Н. Феклистова, Н.П. Максимова // Бюллетень Московского общества испытателей природы. – Отд. биол., 2009. – Т. 114. – Вып. 2. – С.110-112 .

103. Храмцова, Е.А. Синтез индол-3-уксусной кислоты ризосферными бактериями Pseudomonas mendocina. Характеристика регуляторных мутантов / Е.А. Храмцова, С.С. Жардецкий, Н.П. Максимова // Вестн. Белорус. гос. ун-та. Сер. 2: Химия .

Биология. География. 2006- № 2 – С.69-73 .

104. Храмцова, Е.А. Регуляция биосинтеза триптофана у бактерий Pseudamonas mendocina и Pseudamonas marginata / Е.А. Храмцова, И.Н. Олехнович, Ю.К. Фомичев / Генетика .

– 1996. – Т. 32, № 8. – С.1051-1055 .

105. Храмцова,Е.А. Синтез индол-3-уксусной кислоты ризосферными бактериями Pseudomonas mendocina / Е.А. Храмцова, С.С. Жардецкий, Л.Е. Садовская, Н.П .

Максимова // Научные труды Молекулярная и прикладная генетика.- Минск: Институт генетики и цитологии Национальной академии наук Беларуси - Минск, 2006. – Т.3. – С.146-153 .

106. Stearns, J. C. Transgenic plants with altered ethylene biosynthesis or perception / J. C .

Stearns, B. R Glick. // Biotechnol. Adv. – 2003. – V.21. – Р.193-210






Похожие работы:

«тов, например, мороженое с использованием натуральных сливок из коровьего молока, сахара, а из стабилизаторов муки или крахмала. С другой стороны, традиционные виды сырья в настоящее время мог...»

«Journal of Siberian Federal University. Chemistry 2 (2014 7) 280-287 ~~~ УДК 544.3:546.1:669.053 О возможности эффективного извлечения хлора из хлорида кальция бромоводородом Е.О. Зайцева*, А.Д. Кустов, О.Г. Парфенов Институт химии и химической технологии СО РАН Россия, 66003...»

«СРГ ПДООС ПОВЕСТКА ДНЯ УЧЕБНОГО СЕМИНАРА "ОЦЕНКА ЭКОЛОГИЧЕСКИХ ПРОЕКТОВ, ФИНАНСИРУЕМЫХ ЗА СЧЕТ ГОСУДАРСТВЕННЫХ СРЕДСТВ" УЧЕБНЫЙ СЕМИНАР ДЛЯ ЭКСПЕРТОВ МОЛДОВЫ 16 – 19 ЯНВАРЯ 2007 Г., КИШИНЕВ Исходная информация Последние несколько лет совершенствование управления государственными при...»

«УТВЕРЖДАЮ И.о. директора ИПР В.С. Рукавишников "" 2016 г. БАЗОВАЯ РАБОЧАЯ ПРОГРАММА ДИСЦИПЛИНЫ СИСТЕМНО-ЭКОЛОГИЧЕСКИЙ АНАЛИЗ ЗЕМЛЕУСТРОЙСТВА ТЕРРИТОРИИ Направление ООП 21.04.02 "Землеустройство и кадастры" Профиль подгот...»

«ЮБИЛЕИ И ДАТЫ Самарская Лука: проблемы региональной и глобальной экологии. 2010. – Т. 19, № 3. – С. 187-199. УДК 01+092.2 АНДРЕЙ ЛЬВОВИЧ МАЛЕНЁВ (К 50-ЛЕТИЮ СО ДНЯ РОЖДЕНИЯ) © 2010 Г.С. Розенберг; А.Г. Бакиев, О.Л. Носкова, С.В. Саксонов* Институт экологии Волжского бассейна РАН,...»

«Известия Челябинского научного центра, вып. 2 (32), 2006 МЕДИКО–БИОЛОГИЧЕСКИЕ ПРОБЛЕМЫ УДК.612.014.482 АНТИОКСИДАНТНЫЙ СТАТУС КЛЕТОК СЕЛЕЗЕНКИ МЫШЕЙ СВА, ПОДВЕРГАВШИХСЯ ГАММА–ОБЛУЧЕНИЮ В ТЕЧЕНИЕ ЖИЗНЕННОГО ЦИКЛА А.А. Устинова e–mail: suddha_nama_ids@mail.ru Челябинская г...»

«УДК 615.074, 615.072 РАЗРАБОТКА МЕТОДИКИ СТАНДАРТИЗАЦИИ ТРАВЫ РЕПЕШКА ОБЫКНОВЕННОГО AGRIMONIA EUPATORIA ПО ФЛАВОНОИДАМ Ж.С . Лесовая Надземная часть репешка обыкновенного используется в народной медицине при лечении многих заболеваний, в частности, Д.И. Писарев заболеваний печени и ж...»

«КОНФЕРЕНЦИИ "Газоочистка 2005" испытание электричеством выдержала России предстоит усовершенствовать подходы к решению экологических задач и внедрить ряд новых технологий Петр Степаненко К онференция специалистов по очистке газов от загрязнений и применению серы, орган...»

«Выполненные эксперименты и сравнение полученных результатов с литературными данными позволяют сделать следующие выводы: В ходе исследований установлены видовые различия в накоплении химических элементов водными растениями. Аккумулирующая способность Lemna min...»

«ПРОГРАММА ВСТУПИТЕЛЬНОГО ИСПЫТАНИЯ ПО БИОЛОГИИ 1. Биология как наука. Методы научного познания. Биология как наука, ее достижения, методы исследования, связи с другими науками. Роль биологии в жизни и практиче...»

«Известия Челябинского научного центра, вып. 4 (21), 2003 БИОЛОГИЯ УДК 574.5(28):591.553 НЕКОТОРЫЕ ЗАКОНОМЕРНОСТИ ЦЕНОТИЧЕСКОГО РАЗНООБРАЗИЯ НА ПРИМЕРЕ ПЛАНКТОННЫХ СООБЩЕСТВ ОЗЕР ИЛЬМЕНСКОГО ЗАПОВЕДНИКА И СОПРЕДЕЛЬНОЙ ТЕРРИТОРИИ А.Г. Рогозин e–mail: rogozin@ilmeny.ac.ru Ильм...»




 
2019 www.mash.dobrota.biz - «Бесплатная электронная библиотека - онлайн публикации»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.