WWW.MASH.DOBROTA.BIZ
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - онлайн публикации
 

Pages:   || 2 |

«КУСТ НАДЕЖДА НИКОЛАЕВНА ГЕНЕТИЧЕСКИ ДЕТЕРМИНИРОВАННАЯ ДИФФЕРЕНЦИРОВКА ПРОГЕНИТОРНЫХ КЛЕТОК ПОД ВОЗДЕЙСТВИЕМ GDNF ...»

-- [ Страница 1 ] --

Федеральное государственное бюджетное учреждение наук

и

Институт биологии гена Российской академии наук

на правах рукописи

КУСТ НАДЕЖДА НИКОЛАЕВНА

ГЕНЕТИЧЕСКИ ДЕТЕРМИНИРОВАННАЯ

ДИФФЕРЕНЦИРОВКА

ПРОГЕНИТОРНЫХ КЛЕТОК ПОД ВОЗДЕЙСТВИЕМ GDNF

03.01.07 - молекулярная генетика

Диссертация на соискание учёной степени кандидата биологических наук

НАУЧНЫЙ РУКОВОДИТЕЛЬ:

д.б.н., профессор РАН Павлова Г.В .

Москва

ОГЛАВЛЕНИЕ

СПИСОК СОКРАЩЕНИЙ 5

ВВЕДЕНИЕ 6 ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ 15

1. Понятия о нейротрофических факторах 15

1.1. Классификация нейротрофических факторов 16

1.2. Сравнительная характеристика представителей семейства GDNF лигандов. 17 1.2.1.Артемин (ARTN) 17 1.2.2. Нейртурин (NRTN) 18 1.2.3. Персефин (PSPN) 18 1.2.4. Глия-производный нейротрофический фактор (GDNF) 19

2. Рецепторы нейротрофических факторов. 25

2.1. Рецепторы семейства GDNF 25

2.2. Характеристика GFR рецепторов 28 2.2.1. Особенности структуры GFRs рецепторов семейства GDNF (GFRs) 29

2.3. Характеристика рецептора тирозинкиназы. 31 2.3.1. Особенности структуры RET 33



2.4. Образование GDNF-GFR-RET комплекса 35

3. Влияние GDNF на нейральные клетки 37

4. Возможные способы применения GDNF в клинике. 39

5. Hsp70 промотор, как регулируемая система активации гена 42

5.1. Фактор теплового шока (HSF) 44 5.1.1. Понятие о факторе теплового шока (HSF) 44 5.1.2. Классификация факторов теплового шока (HSF) 45

5.2. Основные характеристики промотора hsp70 48 5.2.1. Этапы регуляции промотора hsp70 48 5.2.2. Особенности строения промотора hsp70 50 ГЛАВА 2. МАТЕРИАЛЫ И МЕТОДЫ 54

2.1. Объекты 54 2.1.1. Белки, ферменты и реактивы

–  –  –

СПИСОК СОКРАЩЕНИЙ

NGF (nerve growth factor) - фактор роста нервов NT-3 (neurotrophin-3)-нейротрофин-3 NT-4/5 (neurotrophin-4/5) - нейротрофин-4/5 GDNF (glial cell line-derived neurotrophic factor) – глиальный нейротрофический факторBDNF (brain derived neurotrophic factor) – нейротрофический фактор мозга TGF (transforming growth factor) -трансформирующий ростовой фактор PDGF (рlatelet-derived growth factor) - тромбоцитарный ростовой фактор CNTF (ciliary neurotrophic factor) - цилиарный нейротрофический фактор FGF (fibroblast growth factor) - кислый фактор роста фибробластов EGF (epidermal Growth Factor)-эпидермальный фактор роста мезэнцефалический MANF (mesencephalic astrocyte-derived neurotrophic factor) астроцитарный нейротрофический фактор NRTN (neurturin) - нейртурин ARTN (artemin)-артемин PSPN (persephin)- персеферин RET- рецепторная тирозин киназа GFR (1-4) – (GDNF family receptor-) – семейство корецепторов GDNF GPI- гликозилфосфатидилинозитол ENS-энтеральная нервная система PNS-переферическая нервная система CNS- центральная нервная система CLDs-кадхерин-подобный домен Ser –аминокислота серин cAMP–циклический аденозин -3’-5’ -монофосфат CREB – ответный элемент связывающего белка HSF-фактор теплового шока HSE –элемент теплового шока HSTF –хит-шок транскрипционный фактор HSPs – белки теплового шока eEF1A – трансляционный фактор элонгации MPTP – МФТП (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) – 1-метил-4-фенил-1,2,3,6тетрагидропиридин

ВВЕДЕНИЕ



Актуальность проблемы Развитие и сохранение нервной системы регулируется огромным множеством молекул, включая малые секреторные белки, именуемые нейротрофическими факторами .

Первым фактором роста, на котором была показана способность стимулировать рост и поддержание жизнедеятельности нейронов, был фактор роста нервов NGF (LeviMontalcini and Hamburger, 1951). Впоследствии, были идентифицированы еще несколько других факторов, которые могут регулировать сохранение жизнедеятельности и дифференциацию нервных клеток. Некоторые из этих факторов роста являются также активными и в тканях не нервного происхождения. Основными регуляторами в эмбриогенезе и в процессах развития центральной нервной системы представлены многочисленными нейротрофическими факторами BDNF, СNTF, GDNF, NT3 и NT4/5, а также факторами роста клеток широкого действия: EGF, aFGF, bFGF, PDGF, TGF-b (Mc Kay, R. 1997). Терапевтический потенциал факторов роста стимулировал интенсивное исследование их метаболизма и взаимодействий. Большинство нейронов продуцируется на ранних стадиях развития нервной системы. В ходе нормального развития нервной системы значительная часть нейронов отмирает посредством механизма запрограммированной клеточной смерти - апоптоза. Избыточное продуцирование нейронов предоставляет возможность для их адаптивного использования на протяжении развития нервной ткани (Oppenheim, Согласно первоначальной модели, 1991) .

нейротрофические факторы синтезируются в ограниченном количестве, так что только те нейроны, которые снабжаются ими, имеют возможность выжить в процессе развития (Thoenen and Barde, 1980). Позднее, было показано, что, для многих популяций нервных клеток выживание регулируется комплексом из нескольких нейротрофических факторов (Davies, 1996). Большинство нейротрофических факторов в центральной нервной системе могут быть сгруппированы в семейства на основании их структурной гомологии .

Особое внимание в изучении нейротрофических факторов уделяют глиальному нейротрофическому фактору (неполный перевод с английского: glial cell line-derived neurotrophic factor GDNF). Глиальный нейротрофический фактор был идентифицирован в среде, в которой культивировались клетки глиальной клеточной линии В49. Свойства GDNF были охарактеризованы на основе способности содействовать выживанию клеток, а также увеличению их размера и длины нейритов мезенцефалических дофаминергических нейронов in vitro. (Lin, 1993; Lin, 1994) .

GDNF первоначально считали селективным фактором выживания для нигростриарных дофаминергических нейронов. Это обусловлено его позитивным влиянием на трофику и жизнеспособность мезэнцефалических дофаминергических нейронов. Массовая гибель этих нейронов наблюдается при социально значимом нейродегенеративном заболевании болезни Паркинсона, поэтому к изучению этого фактора сразу было привлечено внимание многих исследовательских групп (Stromberg, 1993). Однако оказалось, что эффекты, обусловленные GDNF, этим не исчерпываются .





GDNF также поддерживает выживание мотонейронов спинного мозга (Henderson, 1994) и норадренергических нейронов мозга (Arenas, 1995), а также стимулирует выживание, миграцию и дифференцировку некоторых периферических нейронов (Trupp, 1995). GDNF также способствует поддержанию моторных, симпатических, парасимпатических, сенсорных и энтеральных нейронов, и помимо этого, за пределами нервной системы регулирует развитие почек и сперматогенез. (Airaksinen, 2002; Paratcha, 2008) .

То, что GDNF является одним из самых мощных защитных факторов дофаминергических нейронов, стало основной причиной интенсивного изучения его действия в экспериментальных моделях болезни Паркинсона. Эксперименты на грызунах и приматах показали эффективность GDNF как потенциального терапевтического агента .

В этих экспериментах исследовано нейропротективное и нейрорегенеративное действие GDNF, который применяли как в виде инъекции раствора рекомбинантного белка, так и в виде трансгенных клеток, трансфицированных конструкциями, содержащими ген GDNF .

Применялись также вирусные векторы с геном GDNF. В настоящее время ведутся поиски биологических подходов применения GDNF в терапии нейродегенеративных заболеваний мозга. Так как белковые препараты не проникают через гематоэнцефалический барьер, они должны быть инъецированы непосредственно в паренхиму мозга. Клинические исследования рекомбинантного GDNF при интрацеребровентрикулярном введении больным болезнью Паркинсона не показали положительных результатов. Первые опыты не увенчались успехом, но перспективны применения GDNF не должны останавливать дальнейшие исследования, направленные на создание новых препаратов на его основе .

Возможным путем достижения эффективности GDNF является модификация молекулы рекомбинантного фактора и получения соответственно генно-инженерных конструкций с его содержанием. Интенсивное изучение GDNF выявило большое разнообразие его изоформ. Изоформы GDNF имеют особенности в секреции, а также большое количество рецепторных комплексов, на которые они влияют. Однако, многие особенности синтеза, секреции, рецепторных взаимодействий и сигналинга с участием GDNF остаются невыясненными и требуют дальнейшего изучения. Для исследования нейротрофических свойств различных вариантов GDNF человека в нашей работе мы использовали методы создания генно-инженерных конструкций. На основе данных конструкций были получены трансгенные клеточные линии, содержащие различные изоформы GDNF. Использование полученных генетических конструкций и кондиционной среды помогло выявить интересные особенности экспрессии и секреции генных продуктов, а также их нейротрофических свойств. Изучение полученных трансгенных клеток позволило оценить возможности применения генно-клеточных препаратов на животных моделях нейродегенеративных заболеваний .

Для повышения эффективности генно-клеточных препаратов не менее важно обеспечить эффективный режим экспрессии трансгенного белка. В настоящее время известно, что постоянная экспрессия трансгенного фактора может отрицательно влиять как на трансгенную клетку, так и на окружающие ткани организма при трансплантации .

(Black J.L. at al., 2003). В связи с этим, особый интерес представляет поиск регулируемых промоторов. В своем исследовании мы предложили модель, где промотор гена белка теплового шока HSP70 Drosophila melanogaster будет выполнять роль промотора и регулировать работу связанного с ним гена. Данный промотор, является представителем из класса регулируемых промоторов, и начинает свою работу в отсутствии воздействия антибиотиков или каких-либо химических агентов. Активация данного промотора происходит не только при нагревании трансгенной клетки, но и при наличии тканевых сигналов воспаления. Наше исследование направлено на комбинацию использования свойств GDNF и промотора гена белка теплового шока HSP70 в очаге воспаления при нейродегенеративном заболевыании (на примере болезни Паркинсона). Данное сочетание даст локальное и точечное применение нейротрофичесокго фактора, при терапии .

Степень разработанности темы исследования Исследования последних десятилетий показали, что представители семейства GDNF признаны значимыми для поддержания жизнеспособности зрелых клеток нервной системы и в качестве индукторов стимулирующих нейральную дифференцировку прогениторных (незрелых) клеток. Они являются важными для развития, поддержания и функционирования не только нейронов, но и глиальных клеток. Члены семейства GDNF характеризуются несколькими активностями: способностью участвовать в контроле над несколькими типами процессов, от выживания нейронов и роста аксонов и формирования синапсов в развивающейся нервной системе, до координации синаптической функции и регенеративных ответов у взрослых. (Ibez et al.,2017) характеризуется как нейротрофический фактор, необходимый для GDNF, поддержания жизнеспособности дофаминергических нейронов головного мозга, а также играет значимую роль в работе периферических, симпатических, парасимпатических и сенсорных нейронах. (Baudet et al., 2000; Fundin et al., 1999; Jing et al., 1996; Ohnaka et al., Trupp et al., 1995). Показано, что GDNF поддерживает 2012; Rossi et al., 1999 ;

жизнеспособность двигательных и дофаминергических нейронов. (Henderson et al., 1994;

Из всего ряда нейротрофических Evans and Barker, 2008; Chermenina et al., 2014) .

факторов GDNF признан, самым эффективным, например, показано, что он в пять-десять раз более эффективен, чем BDNF для выживания в поврежденных нейронов крыс (Lu and Hagg, 1997). Столь привлекательный набор свойств GDNF не мог не обратить на себя внимание ученых и разработчиков лекарственных средств. Были предприняты попытки на основе GDNF разработать терапию нейродегенеративных заболеваний. В качестве первого заболевания, на котором планировалось изучать эффективность воздействия GDNF, была выбрана болезнь Паркинсона. (Sampaio TB et al., 2017). Известно, что болезнь Паркинсона (PD) связана с утратой нейронов дофаминэргических нейронов среднего мозга (Bjrklund and Dunnett, 2007; Meissner et al., 2011). Изучалась возможность введения GDNF, (белка или с использование генной терапии) и его воздействие на дифференцировку новых нейронов в зоне поражения или поддержание жизнеспособности уже существующих .

Доклинические исследования, которые были проведены на грызунах (Beck et al., 1995; Hoffer et al., 1994; Tomac et al., 1995; Winkler et al., 1996) и приматах (Gash et al.,

1996) показали эффективность GDNF как потенциального терапевтического агента .

Однако результаты клинических испытаний на людях оказались противоречивыми .

Клинические исследования рекомбинантного GDNF при интрацеребровентрикулярном введении больным болезнью Паркинсона показали, что улучшения были незначительны или отсутствовали, стало понятно, что необходимы дополнительные исследования в области физиологического воздействия фактора на организм. (Ibez et al., 2017) .

Изначально, значимый эффект наблюдался, при введении рекомбинантного GDNF в полосатое тело мозга пациента, с помощью минипомпы, (Gill et al., 2003.). Однако потом не был подтвержден на двойной слепой фазе II клинических испытаний, которые проводила компания Amgen. В результате компания отказалась от дальнейших клинических исследованиий. Также были остановлены два других клинических испытания GDNF, с использованием как белка, так и генной терапии с применением адено-ассоциированного вируса (AAV). Было обнаружено, что при введении GDNF, наблюдалось аббератное прорастание повторно иннервирующих аксонов к области инъекции GDNF (Georgievska et al., 2002; Georgievska et al., 2004; Hudson et al., 1995). Тем не менее, принимая во внимание хорошо известные протективные свойства GDNF, научное и бизнес сообщества не прекращают попыток найти способ применения этого фактора в лечении нейродегенеративных заболеваний. Так компании MedGenesis Therapeutix и Pfizer заключили соглашение по совместной разработке методов применения GDNF и методами расширенной доставки для лечения болезни Паркинсона. Одним из возможных путей достижения эффективности GDNF является модификация молекулы рекомбинантного фактора .

В данной работе предложена гипотеза о том, что в организме синтезируются разные формы GDNF, которые обладают различными свойствами. В связи с этим актуально исследование изоформ GDNF и изучение роли pro-последовательности в сохранении вышеописанных свойств фактора .

Таким образом, область нашей задачи исследования характеризуется поиском наиболее активной формы GDNF и поиском невирусной доставки в очаг поражения и регулировки экспрессии нейротофического фактора. На основании вышесказанного были определены цель и задачи настоящего исследования .

Цели и задачи исследования

Целью данной работы является: Исследование путей возможного улучшения и контроля нейроиндукторных свойств GDNF человека .

Для достижения данной цели были поставлены следующие задачи:

1. Получение генетических конструкций, содержащих GDNF/GFP с удаленными преи про- областями GDNF в различных комбинациях под контролем CMVпромотора .

2. Исследование эффективности экспрессии и секреции хGDNF/GFP в культуре трансгенных клеток .

3. Анализ свойств химерных белков хGDNF/GFP как стимуляторов нейральной дифференцировки in vitro .

4. Анализ поведения трансгенных клеток, продуцирующих эффективный вариант хGDNF/GFP, при трансплантации в мозг модельных животных .

5. Получение иизучение регулируемой системы экспрессии GDNF на примере использования промотора hsp70 Drosophila melanogaster

Научная новизна

В настоящей работе впервые дана сравнительная характеристика эффективности воздействия четырех изоформ глия-производного нейронального фактора GDNF на дифференцировку культуры клеток ганглиев. Для трансгенных клеточных линий было показано, что химерные белки, нейротрофического фактора GDNF, и зеленого флуоресцентного белка GFP, выходят из клетки в питательную среду вне зависимости от модификаций Продемонстрировано, что среда, кондиционированная GDNF .

трансгенными клеточными культурами может быть использована, как индуктор нейрональной дифференцировки. В работе представлена система регуляции экспрессии трансгена с использованием регуляторного hsp70 промотора гена белка теплового шока дрозофилы. Преимущество использования данной системы регуляции состоит в запускать каскад экспрессии гена, используя лишь состояние стресса (например повышение температуры) и не требует использования дополнительных химических агентов .

Теоретическая и практическая значимость работ

Полученные результаты позволяют расширить представление об использовании генно-инженерных конструкций, сдвигающих дифференцировку стволовых и прогениторных клеток в нейрональном направлении, и благоприятно влияющих на приживляемость трансплантата. Исследование функционирования полученных конструкций в трансфицированных клетках в культуре до и после трансплантации имеют решающее значение для развития клеточной и генной терапии. Огромное значение при этом играет выбор факторов с нейропротекторными свойствами. Результаты работы представляют особый интерес в изучении глия-производного нейротрофического фактора (GDNF), как фактора жизнеспособности дофаминэргических нейронов головного мозга .

Нами показано, что при применении mGDNF происходит восстановление утраченных нейронов после их разрушения вследствие воздействия нейротоксина, имитируещего болезнь Паркинсона .

Методология и методы исследования

Работа выполнена с использованием современного оборудования и методов молекулярной и клеточной биологии. В ходе выполнения диссертационной работы был использован широкий диапазон методов, включающих методики молекулярного клонирования, иммуноцитохимического окрашивания, Вестр-блот анализа, ПЦР, обратная транскрипция, клеточной биологии и т.д .

Положения выносимые на защиту

1. Делеция pre- и prо-последовательностей гена GDNF не нарушает секрецию GDNF из клетки .

2. mGDNF/GFP (с делецией pre- и prо-последовательностей) секретируется из клетки в среду

3. Делеция только pre-последовательности GDNF блокирует его способность стимулировать образование нейральных отростков у эмбриональных спинальных ганглиев крысы .

4. Делеция prо-последовательности GDNF не снижает способности фактора стимулировать образование нейральных отростков у спинального эмбрионального ганглия крысы .

5. Имплантация трансгенных клеток НЕК293 продуцирующих mGDNF/GFP редуцирует эффект пронейротоксина MPTP на мышиной модели болезни Паркинсона .

6. Увеличение количества HSE последовательностей с 4 до 8 перед промотором hsp70 Dr.melanogaster значительно усиливает его чувствительность к температурному воздействию в клетках млекопитающих .

7. При трансплантации в мозг мышей с фокальной церебральной ишемией клеток НЕК293 с GDNF/GFP под контролем промотора hsp70 Dr.melanogaster с 4 или 8 HSE последовательностями в предпромоторной области GDNF/GFP активно синтезируется .

Степень достоверности и апробация результатов Результаты работы были опубликованы в 4 рецензируемых научных журналах и представлены на 6 научных конференциях. По работе получены два патента. Цель, поставленная в работе, достигнута .

Публикации:

1. Павлова Г.В., Куст (Канайкина) Н.Н., Пантелеев Д.Ю., Охотин В.Е., Рыбалкина Е.Ю., Ревищин А.В. Управление нейральной дифференцировкой стволовых/прогениторных клеток. // В книге: Стволовые клетки и регенеративная медицина. - 2011.- ISBN 978-5-317-03583-9. -С. 82-102 .

2. Павлова Г.В., Куст (Канайкина) Н.Н., Пантелеев Д.Ю., Охотин В.Е., Ревищин А.В .

Трансгенные клеточные культуры, синтезирующие нейротрофические факторы, и возможности их применения в терапии. // Онтогенез. - 2012.- № 43.- С.66-72 .

3. Kust N., Rybalkina E., Mertsalov I., Savchenko E., Revishchin A., Pavlova G. Functional analysis of Drosophila HSP70 promoter with different HSE numbers in human cells. // PLoS One. -2014.-Т. 9(8): e101994 .

4. Kust N., Panteleev D., Mertsalov I., Savchenko E., Rybalkina E., Revishchin A., Pavlova G. Availability of Pre- and Pro-regions of Transgenic GDNF Affects the Ability to Induce Axonal Sprout Growth. //Mol Neurobiol. Mol Neurobiol.- 2015.- Т.51.-№ 3.С.1195-205 .

Патенты

–  –  –

Научные конференции

1. Канайкина Н.Н. (Куст), Ревищин А.В., Никитина И.Г., Павлова Г.В. Исследование возможного управления функционированием чужеродных генов, введенных в стволовые клетки млекопитающих, с помощью промотора теплового шока дрозофилы. Пятый московский международный гонгресс «Биотехнология:

состояние и перспективы развития», 16-20 марта, 2009, Москва, Россия, стр. 362

2. Kanaykina N. (Kust), Revishchin A., Pavlova G. Elaboration of new vectors under temperature influence for therapy. The ninth international conference “High medical technologies in XXI century, October 24-31, 2010, Benidorm, Spain, р.55

3. Куст Н.Н., Пантелеев Д.Ю., Рыбалкина Е.Ю., Савченко Е.А., Ревищин А.В., Павлова Г.В. Влияние моцифицирования GDNF на его активность, как индуктора нейралной дифференцировки прогениторных клеток. V Всероссийская научнопрактическая конференция «Стволовые клетки и регенеративная медицина». 18-21 ноября 2013 Россия, Москва. стр.45

4. G. Pavlova, N. Kust, D. Panteleev, I. Mertsalov, E. Rybalkina, E. Savchenko, A .

Revishchin. Effects of GDNF and its synthetic modifications to the nerve cells. 38th FEBS 2013, 6–11 July 2, St Petersburg, Russia, p.- 208

5. G. Pavlova, N. Kust, D. Panteleev, O. Matveeva, E. Rybalkina, E. Savchenko, A.Revishc hin. Control of neural differentiation of progenitor cells with new versions of GDNF. Special Issue: FEBS EMBO 2014 Conference, 30 August-4, September, 2014, Paris, France. Т.- 281 (Suppl 1), p.- 223

6. Pavlova G., Kust N., Panteleev D., Shamadykova, Dj. Rybalkina E., Revishchin A. Protective and trophic properties of GDNF and its modifications for cells. EMBO Conference: Chemical biology, 31 Aug- 3 Sep 2016, Germany, p.-192 Структура и объем работы Диссертация состоит из следующих разделов: введение, обзор литературы, материалы и методы, результаты и обсуждения, заключения, выводов и списка литературы. Работа изложена на 153 страницах, включает 3 таблицы и 40 рисунков .

Библиография включает 325 источников .

Личный вклад автора Автор внесла существенный личный вклад в получение изложенных в диссертации новых научных данных. Автором выполнен основной объем работы: создание генетических конструкций, получение трансгенных линий НЕК 293 с геном GDNF и их анализ. Проведение ПЦР анализа, Вестерн-блот гибридизация, ELISA. Изучение действия кондиционной среды на моделях in vivo и in vitro выполнено совместно с соавторами, указанными в публикациях. Кроме того, соискатель принимала участие в разработке стратегии научного исследования и написании статей .

Глава 1 . ОБЗОР ЛИТЕРАТУРЫ Настоящий обзор разделен на две части .

Первая часть посвящена нейротрофическому фактору описывается место среди других GDNF: GDNF нейротрофических факторов, представлена сравнительная характеристика представителей семейства GDNF. Особое внимание уделяется описанию рецепторного комплекса GDNF во взаимосвязи с GFR и RET. Параграфы 3 и 4 посвящены описанию влияниия GDNF на нейральные клетки, а также возможности применения GDNF в клинике. Вторая часть обзора посвящена регулируемой системе трансгена, на примере промотора гена белка теплового шока hsp70 Dr.melanogaster. Представлены основные понятия о факторах теплового шока, а также классификация и основные этапы регуляции промотора .



1. Понятия о нейротрофических факторах

Развитие нервной системы в эмбриогенезе, а также поддержание жизнеспособности нейронов в течение жизни регулируется огромным множеством молекул. Значимую роль в этих процессах играют малые секреторные белки, именуемые нейротрофическими факторами. Первым фактором роста, на котором была показана способность стимулировать рост и поддерживать жизнедеятельность нейронов, был фактор роста нервов Впоследствии, были NGF (Levi-Montalciniand Hamburger, 1951) .

идентифицированы другие факторы этого семейства, которые могут регулировать сохранение жизнедеятельности и дифференцировку нервных клеток. Некоторые из этих факторов роста экспрессируются не только в нейронах, но и в других типах клеток .

Например, глиальный нейротрофический фактор GDNF, секретируется, в нейронах (Schmidt-Kastner et al., 1994; Choi-LundbergandBohn 1995), а так же в клетках Сертоли (Trupp et al., 1995), в астроцитах (Schaar et al.,1993; Ho et al., 1995), в Швановских клетках (Springer et al., 1995) .

Ввиду терапевтического потенциала нейротрофические факторы начали активно исследоваться. Thoenen и Barde в 1980 году выдвинули гипотезу, что для выживания каждого типа нейронов необходим свой конкретный нейротрофический фактор (Thoenen and Barde 1980). Однако в данном контексте встал вопрос о том, что же такое «нейротрофический фактор»? Por и Huttner в своем обзоре пытались дать подобное определение и столкнулись с тем, что некоторые неорганические молекулы могут так же стимулировать выживание куриных симпатических нейронов нейронов. (Por SB и Huttner WB,1984). В более поздней работе Mitsumoto и Tsuzaka дали определение, что «нейротрофические факторы являются сигнальными белками, которые поддерживают выживаемость нейронов и стимулируют их дифференцировку, а также могут повышать разрастание нейральных отростков и влиять на секрецию нейротрансмиттеров»

(Mitsumoto et al., 1999). Однако до сих пор нет четкого понимания, важен ли нейротрофический фактор для собственно продуцирующей нейральной клетки или его воздействие значимо для соседствующих с продуцентов нейронов. Согласно Bardе (Barde, Y.-A., 1988) в конечном итоге исследователи определили следующие критерии в определении нейротрофического фактора: молекула должна 1) секретироваться нейронами или сопутствующими нейральными клетками 2) поддерживать жизнеспособность нейронов 3) секретироваться в незначительных количествах для поддержания выживания специфических нейронов 4) стимулировать развитие и дифференцировку нейронов. В конечном итоге было принято научным сообществом, что минимальными требованиями к нейротрофическому фактору является то, что фактор должен секретироваться в нейральных клетках и обладать способностью поддерживать жизнеспособность зрелых нейронов, а также влиять на дифференцировку в нейральном направлении прогениторных клеток in vivo .

Позднее, было показано, что для многих популяций нейральных клеток выживание регулируется комплексом из нескольких нейротрофических факторов (Davies, 1996). На основе структурной гомологии и аналогии воздействия на клетки исследователи сформировали классификацию нейротрофических факторов .

1.1. Классификация нейротрофических факторов

Выделяют следующие четыре семейства нейротрофических факторов:

нейротрофины, нейрокины, семейство (мезэнцефалический астроцитный MANF нейротрофический фактор) и семейство GFLs. Классификация основана на гомологии аминокислотной последовательности нейротрофических факторов (Frade at al., 1999) Нейротрофины (NTs) являются наиболее хорошо изученными и широко экспрессирующимися в мозгу нейротрофическими факторами. Семейство нейротрофинов представлено: фактором роста нервов (NGF - nerve growth factor), нейротрофическим фактором мозга (BDNF), нейротрофином 3 (NT-3) и нейротрофином 4 (4\5) (NT-4(4/5) (Barbacid,1994; Ip, Yancopoulos, 1994) .

Нейрокины также называют нейропоэтическими цитокинами или CNTFсемейством, они представляют собой маленькие молекулы, которые структурно очень близки к цитокинам, а в сигнальном пути задействуют основные компоненты цитокинового рецептора (AdlerR еt al., 1979). Участниками CNTF-семейства являются интерлейкин 6 (IL-6), кардиотрофин 1 и 2 и фактор ингибирования лейкемии (LIF) (Ip, Yancopoulos, 1996) .

MANF семейство состоит из MANF (ARMET) и CDNF (Shrihar et al., 1996; Petrova et al., 2003; Lindholm et al., 2007) .

GFL участники включают: семейство GDNF, неуритрин (NRTN), артемин (ARTN) и персеферин (PSPN), все они принадлежат к одному TGF- суперсемейству (Lin, et al., 1993). Ниже будет подробно рассмотрено семейство лигандов глия-производного нейротрофического фактора .

1.2. Сравнительная характеристика представителей семейства GDNFлигандов .

Глия-производный нейротрофический фактор (GDNF) является одним из членов семейства белков, названного «лиганды семейства GDNF (GFLs)» или «нейротрофические факторы семейства GDNF». Это семейство включает в себя глия-производный нейротрофический фактор (GDNF) (Lin et al., 1993), нейртурин (NRTN) (Kotzbauer et al., 1996), артемин (ARTN) (Baloh et al., 1998; Masure et al., 1999), персефин (PSPN) (Mildbrandt et al., 1998). GFL участники семейства GDNF принадлежат к TGFсуперсемейству и принимают участие в развитии, дифференцировке и сохранении огромного числа нейронов различного типа (Airaksinen et al., 1999) .

1.2.1.Артемин (ARTN)

Артемин является фактором роста и сохранения жизнедеятельности для симпатических и сенсорных нейронов in vitro (Baloh et al., 1998; Enomoto et al., 2001), и, что наиболее важно, нейропротекторным фактором для нигростриальных дофаминэргических нейронов млекопитающих in vivo, что было показано на грызунах (Rosenblad et al .

, 2000). Аминокислотный состав ARTN более близок к NRTN и PSPN составам, чем к GDNF (Baloh et al., 1998). мРНК ARTN экспрессируется в мозговой и различных других тканях, при этом, уровень экспрессии выше в периферических тканях, включающих простату, плаценту, поджелудочную железу, сердце и почки (Masure et al., 1999). ARTN регулирует сенсорную функцию клеток (Wang et al., 2008) и потенциально применим в лечении хронической боли (Gardell et al., 2003). ). Подобно GDNF и NRTN, ARTN также синтезируется в пре-про- форме, из которой в результате процессинга формируется зрелый белок, состоящий из113 аминокислот с молекулярным весом около 12 kDa. Подобно GDNF и NRTN, ARTN прочно связывается с гепарином (Alfano et al., 2007) .

1.2.2. Нейртурин (NRTN)

NRTN структурно схож с GDNF. Зрелая форма идентична на 42 % последовательности GDNF. NRTN был впервые изолирован на основе его способности к поддержанию и сохранению жизнедеятельности симпатических нейронов в культуре (Kotzbauer et al., 1996). Стимулирующее влияние NRTN на сохранение жизнедеятельности дофаминэргических нейронов аналогично GDNF (Horger et al., 1998). В ряде работ его рассматривают, как возможную защиту дофаминэргических нейронов от обширной клеточной смерти при прогрессирующей болезни Паркинсона (Rosenblad et al., 1999; Oiwa et al., 2002). Было показано, что NRTN поддерживает сохранение жизнедеятельности и пролиферацию нескольких других нейрональных популяций в центральной и периферической нервной системе (Kotzbauer et al., 1996; Klein et al., 1997; Heuckeroth et al., 1998; Rossi et al., 1999; Golden et al., 2003). Наиболее важно, что NRTN регулирует развитие большинства парасимпатических нейронов (Rossi et al., 1999). NRTN стимулирует эпителиальное ветвление, также может инициировать ветвление в развивающейся почке (Davies et al., 1999), направляет миграцию зачатка печени (Tatsumi et al., 2007) и участвует в функционировании сетчатки (Brantley et al., 2008). Высокая экспрессия NRTN в кишечнике, простате, яичках и яйцеклетке взрослой мыши также говорит о его функциональном значении в этих тканях (Golden et al., 1999). Пре-проформа NRTN состоит из 195 аминокислот и расщепляется, процессируется с образованием 100 фрагментов белка, который имеет молекулярный вес~12 kDa (Kotzbaueret et al., 1996) .

Зрелый NRTN связывает гепарин, с более высокой аффинностью, чем GDNF (Alfano et al., 2007) .

1.2.3. Персефин (PSPN)

Персефин также схож с другими GFLs, показана его идентичность на 40% последовательности GDNF и NRTN. Пре-про- форма PSPN это 156 аминокислотная цепь, которая в результате процессинга ращепляется с образованием 96 аминокислотного зрелого белка с молекулярным весом 10-12 kDa (Milbrandt et al., 1998) (рисунок 1). В ряде работ было показано, что поддерживает жизнеспособность вентральных PSPN дофаминэргических нейронов среднего мозга в культуре, поддерживает жизнеспособность мотонейронов в культуре а также in vivo после перерезки седалищного нерва. После статической нервной аксотомии, подобно GDNF, он стимулирует разветвление узла уретры in vitro (Milbrandt et al., 1998; kerud et al., 2002). Более того, стимулирует сохранение жизнедеятельности эмбриональных базальных PSPN холинэргических нейронов переднего мозга in vitro (Golden et al., 2003). Однако PSPN не поддерживает периферические нейроны. PSPN экспрессируется во многих тканях, однако, обнаруживаемые уровни мРНК достаточно низкие (Milbrandt et al., 1998; Jaszai et al., 1998;

Lindfors et al., 2006). Подводя итог, PSPN стимулирует как сохранение жизнедеятельности, так и нейрогенезис дофаминовых нейронов среднего мозга и, таким образом, показано, что PSPN, подобно GDNF и NRTN, может быть использован для терапии болезни Паркинсона (kerud et al., 2002). Также выдвинуто предположение, что PSPN может применяться и при лечении разрушительных последствий инсульта. (Tomac et al., 2002) .

1.2.4. Глия-производный нейротрофический фактор (GDNF)

GDNF был впервые описан, как нейротрофический фактор, который стимулирует сохранение жизнедеятельности дофаминергических нейронов среднего мозга in vitro (Lin et al., 1993). Это открытие вызвало существенный интерес в связи с симптоматической фазой болезни Паркинсона (PD), нарушениями моторной функции и дегенерацией дофаминергических нейронов в компактной зоне черной субстанции среднего мозга (German et al., 1992). Позднее, было обнаружено, что GDNF является также важнейшим трофическим фактором для спинальных мотонейронов (Henderson et al., 1994) и для центральных норадренэргических нейронов (Arenas et al., 1995). GDNF играет немаловажную роль и вне нервной системы, как например, в развитии почек и сперматогенезе (Moore et al., 1996; Pichel et al., 1996; Sanchez et al., 1996; Meng et al., 2000) .

GDNF широко экспрессируется в центральной и периферической нервных системах (Schaar et al., 1993; Strmberg et al., 1993; Golden et al., 1998), а также и в других тканях и типах клеток (Trupp et al., 1995; Suvanto et al., 1996; Golden et al., 1999). GDNF синтезируется, как 211 аминокислотный прекурсор, в то время, как зрелая секретируемая форма состоит из 134 аминокислот и имеет молекулярный вес ~15kDa. (Lin et al., 1993) .

Однако, как протеолитический процесс, так и секреция GDNF мало изучены .

GDNF белок отличается от других нейротрофических факторов. Во-первых, GDNF белок N-гликозилирован по двум аминокислотным остаткам. Этот факт интересен тем, что, как правило, зрелые факторы роста редко или почти никогда не N-гликолизированы .

Во-вторых, GDNF содержит семь цистеиновых остатков в такой же пространственной конфигурации, как и другие участники TGF- суперсемейства. Аминокислотная последовательность между GDNF и TGF- суперсемейства гомологична менее, чем на 20%, однако структура цистеиновых остатков позволяет определить GDNF, как отдаленного члена этого семейства (Lin et al., 1993) .

Также следует отметить, что GDNF образует «цистиновый узел», как и другие представители семейства TGF-. (Eigenbrot and Gerber, 1997). «Цистиновый узел»

содержит кольцо, состоящее из двух пептидных цепей, скрепленных двумя цистинами .

Третий цистин проходит через кольцо, образуя узел (McDonald et al., 1995) .

Определение кристаллической структуры рекомбинантного GDNF подтверждает, что конформация GDNF очень схожа с двумя охарактеризованными членами TGFсемейства—TGF-2 и BMP-7 (Eigenbrot and Gerber, 1997). При димеризации GDNF по принципу «голова к хвосту» образуется гомодимер, который поддерживается одной дисульфидной связью. Данный гомодимер биологически активен. Молекула GDNF содержит два потенциальных сайта гликозилирования, однако показано, что негликозилированный рекомбинантный GDNF также обладает биологической активностью. (Lin et al., 1993) .

Молекула зрелого GDNF содержит 134 аминокислоты. Показано, что Nтерминальный участок GDNF, в области 37-40 аминокислоты, структурно мобилен .

Кристаллическая структура мономера GDNF, содержит -тяжи, которые формируют два цинковых пальца, и -спираль (рисунок 2). Существует ряд структурных отличий между GDNF и участниками TGF- семейства. Например, участок цинкового пальца GDNF состоит из непрерывных b-нитейтяжей, в то время как -тяжи у TGF-b2 и BMP-7 характеризуются срединными разрывами. Кристаллическая структура GDNF представлена в двух конформациях димера, которые отличаются изгибом петли в центральном участке .

Основываясь на этих результатах исследования структуры GDNF, Eigenbrot и Gerber обнаружили, что и другие члены TGF- суперсемейства могут быть также димерами и могут принимать ряд конформаций в растворе. Кроме того, авторы показали, что при взаимодействии GDNF с рецептором, положительный заряд концентрируется по всей задействованной поверхности -спирали (аминокислоты 81–91), а отрицательный заряд - на участках цинковых пальцев 1 и 2 (Рисунок 1). Незаряженным остается участок в области цинкового пальца 2, образованный аминокислотами: лейцин 118, валин119, и тирозин 120 (Eigenbrot and Gerber, 1997) .

Рисунок 1. Сравнительный анализ последовательностей GFLs .

Сиквенс GDNF, ARTN и PSPN представлены последовательностями крысы, в то время как NRTN представляет собой последовательность мыши, так как сиквенс NRTN крысы не представлен в базе данных. Регионы с высокой степенью сходства последовательностей показаны жирным шрифтом. Структурные и функциональные свойства выделены: Одиночное подчеркивание; -спираль в соответствии со структурой кристаллов из Eigenbrot и Gerber, 1997 (GDNF) и Silvian et al., 2006(ARTN). Двойное подчеркивание; связывания последовательности гепарина/ остаток согласно Alfano et al.,2007 (GDNF) и Silvian et (ARTN). Фиолетовый: остаток цистеина, который входит в состав al.,2006 внутримолекулярных цистеиновых мостов. Зеленый: сигнальный пептид (согласно UniProt). Синий; пропептид (согласно UniProt). Розовый: остатки, взаимодействующие с GFR соответствии с Wang et al.,2006 .

(https://helda.helsinki.fi/bitstream/handle/10138/22022/structur.pdf?sequence=1) Структурно- функциональный анализ показал, что первые 39 аминокислот на Nконце GDNF не требуются для его биологической активности. 3D-структуры N-концевого фрагмента отсутствуют. С-конец имеет решающее значение для стабильности и биологической активности GDNF, поскольку на С-конце нейротрофина расположены сигнальные последовательности, участвующие в связывании GDNF с GFR1-рецептором (Chen Z.Y., et al., 2000; Chen Z., et al., 2000; Parkash V., et al., 2009). Незрелая молекула GDNF состоит из 211 аминокислот, и содержит участки расщепления сигнальной последовательности и продомена. Зрелые молекулы состоят из 134 аминокислот. В процессе созревания происходит гликозилирование белка и образование гомодимера за счет образования дисульфидных связей (Lin 1993) Именно в форме et al., гликозилированного гомодимера реализуются различные биологические функции данного нейротрофического фактора. GDNF синтезируется в виде белка-предшественника — proGDNF .

Рисунок 2. Структура гомодимера GDNF .

Кристаллическая структура GDNF мономера (светло-голубой и розовый) содержит остатки 34-134. Цинковые пальцы 1 и 2 отмечены на рисунке N-концевой структуры (N). Цистеиновый узел находится в центре гомодимера .

Дисульфидные мостики изображены фиолетовым и желтым (указаны стрелками) .

(https://helda.helsinki.fi/bitstream/handle/10138/22022/structur.pdf?sequence=1) Глия-производный нейротрофический фактор (GDNF) является секреторным белком, который широко экспрессируется в ЦНС и периферических тканях. Он синтезируется в формах прекурсора pre-pro-GDNF, с различной длиной pro-области. (Lin et al., 1993). Функции GDNF давно описаны, однако на данный момент мало, что известно о путях секреции изоформ GDNF, отличающихся длиной pro-области, а также непонятно обладают ли эти изоформы различными функциями. (Lonka-Nevalaita et al., 2010). На данный момент есть предположение, что функции модификаций, отличающихся proобластью должны разниться. Рассмотрим в чем отличия этих вариантов GDNF .

У многих млекопитающих, например у человека или грызунов, ген GDNF кодируется двумя матричными РНК, которые продуцируются посредством альтернативного сплайсинга: длинно-цепочный транскрипт [pre-()pro-GDNF] и короткий транскрипт [pre-()pro-GDNF], у которого не хватает 78 н в участке pro-области (SuterCrazzolara и Unsicker, 1994; Trupp et al., 1995; Matsushita et al., 1997; Grimm et al., 1998) .

Группа ученых во главе с M.Saarma подтвердили наличие pre-()pro-GDNF и pre-() proGDNF в головном мозге взрослого человека и мыши, а также в культуре нейральных клеток гиппокампа головного мозга мыши, с помощью секвенирования кДНК. Кроме того, ими было показано, что обе изоформы экспрессируются в эмбриональных культурах клеток линий E13, E15, E17 (Lonka-Nevalaita et al.,2010). Результаты данных исследований опубликованы в статье Lonka-Nevalaita и M. Saarma, где использовались первичные кортикальные нейроны клеточной линии PC-6.3 и субклональные крысиные феохромоцитомы клеточной линии PC12 для изучения, локализации и секреции белков кодированных форм pre-()pro-GDNF и pre-()pro-GDNF. (Lonka-Nevalaita et al., 2010) .

Крысиные нейроэндокринные клетки линии PC-6.3 проявляли нейронально-подобный фенотип при воздействии нейрональных индукторов, например NGF (Pittman et al., 1993) .

Наряду с тем на данной линии клеток было обнаружено, что процессинг и секреция GDNF отличаются от аналогичных процессов, происходящих с BDNF и NGF (Lonka-Nevalaita et al., 2010). В клеточных линиях и первичных нейронах, белки, кодированные pre-()proGDNF и pre-()pro-GDNF имеют различную локализацию. Было обнаружено, что продукт pre-()pro-GDNF транспортируется через аппарат Гольжди и везикулы, тогда как фактор, полученный от pre-()pro-GDNF преимущественно секретируется через секреторные везикулы. Такие отличия в пути секреции двух этих продуктов могут говорить о различиях в их функциях .

Дальнейшее изучение процессинга и секреции GDNF показало, что длина proобласти и C-терминальные цистеины важны для этих процессов (Oh-hashi et al.,2009) .

Наличие pro-областей найдено и у других нейротрофических факторов, у которых, однако, не обнаружен факт наличия двух вариантов длины этой области и взаимосвязи этой длины и пути секреции фактора. Так, например, известно, что фактор роста нервов (NGF) и нейротрофический фактор мозга (BDNF) имеют схожие pro-области и даже описаны pro-формы этих нейротрофических факторов и их функции. Зрелые NGF и BDNF участвуют в поддержании жизнедеятельности нервной клетки, стимулируют дифференцировку и синаптическую модуляцию (Huang и Reichardt, 2001), в то время как pro-BDNF и pro-NGF по ряду исследований, предположительно индуцируют гибель клеток (Lee et al .

, 2001; Nykjaer et al., 2004; Thomas и Davies, 2005). M. Saarma с коллегами посредством Вестерн-блот анализа выявили, что при оверэкспрессии pre-()pro-GDNF и pre-()-pro-GDNF находятся внутри клеток преимущественно в pro-формах и частично обнаруживаются в pro-формах в клеточной ростовой среде. Также было выяснено, что нерасщепленные ()pro-GDNF и () pro-GDNF и расщепленные pro-участки наряду со зрелым GDNF локализуются на клеточной поверхности (Lonka-Nevalaita et al.,2010) .

Предварительный эксперимент по связыванию pro-участков ()pro-GDNF и () pro-GDNF с корецептором GFR1 не дал положительного результата, что говорит о том, что с клеточной поверхностью взаимодействуют в основном pro-GDNF белки, а не отдельные pro-участки. Это означает, что протеолитическое расщепление pro-GDNF с образованием m-GDNF может происходить также вне клеток, скорее всего во внеклеточном матриксе .

Кроме того, pro-GDNF белки могут оставаться в нерасщепленной форме и выполнять специфические функции вне клеток (Lonka-Nevalaita et al.,2010) .

Группой ученых во главе с M.Saarma было показано, что существуют различия не только в секреции GDNF и BDNF/NGF, но и в их процессинге (Lonka-Nevalaita et al.,2010) .

Согласно результатам секвенирования pro-GDNF белок имеет предположительный сайт разрезания фурин-подобной эндопротеиназой KRLKR. Однако никогда не проводилось исследований, доказывающих роль фурин-подобной эндопротеиназы в процессинге proGDNF. M.Saarma и коллегами доказали, что роль фурина в расщеплении pro-GDNF значима. На клеточных линиях было показано, что не только фурин, но также PACE4, PC5A, PC5B и в меньшей степени PC7 принимают участие в процессинге pro-GDNF (Lonka-Nevalaita et al.,2010). Pro-BDNF и pro-NGF в свою очередь также процессируются с помощью фурина, но в отличии от процессов в GDNF, значимую роль здесь играют MMPs и плазмин и в меньшей степени PACE4 и PC5B (Lee et al., 2001; Seidah et al., 1996) .

M.Saarma с коллегами провели эксперимент по внесению мутаций в предполагаемый сайт разрезания pro-GDNF KLKR, однако, выяснилось, что этих мутаций недостаточно для предотвращения разрезания pro-GDNF. Возможно, необходимо внесение дополнительных мутаций в m-GDNF домен (Lonka-Nevalaita et al.,2010). Несмотря на то, что давно известно о существовании изоформы pre-()pro-GDNF, кодируемый белок изучен плохо .

Это объясняется тем, что зрелые белки, кодируемые pre-()pro-GDNF и pre-() pro-GDNF, вероятнее всего схожи, а pro-формы GDNF ранее рассматривались преимущественно как неактивные .

2. Рецепторы нейротрофических факторов .

Рецепторы нейротрофических факторов, представляют собой белки, расположенные на мембране клетки, которые связываются с нейротрофическими факторами (лигандами) и участвуют в регуляции широкого спектра функций клетки, таких как поддержание жизнеспособности, дифференцировки, пролиферации и даже апоптоза. Существует предположение, что нейротрофические факторы синтезируются в ограниченном количестве так, что лишь несколько нейронов могут получить достаточно нейротрофического фактора для поддержания жизнедеятельности. Во избежание запрограммированной клеточной смерти, нейроны вынуждены конкурировать за малое количество трофических факторов. Вследствие этого, является важным, чтобы нейроны экспрессировали рецепторы, которые связывают нейротрофические факторы с высоким аффинитетом и специфичностью (Chao и Hempstead, 1995) .

2.1. Рецепторы семейства GDNF

Наиболее хорошо изученный GFL сигнальный путь осуществляется посредством тетрамерного рецепторного комплекса, который включает две GFR молекулы и два RET рецептора тирозин киназы. (Takahashi et al., 1985; Durbec et al., 1996; Trupp et al., 1996) .

RET активизируется только после того, как GFL присоединяется к GFR,(GDNFсемейство рецептор-), который заякоривается в цитоплазматической мембране через гликозилфосфатидилинозитол (GPI). Благодаря рецепторы GPI-якорю GFR локализуются в липидных рафтах на цитоплазматической мембране клетки (Coulpier et al.,2002) .

Липидные рафты, содержащие включенные в них белки, имеют способность менять размер и строение в ответ на разнообразные стимулы. Некоторые группы белков имеют высокое сродство к липидным рафтам, к примеру, белки, заякоренные в мембране через гликозилфосфатидилинозитол (GPI) (Airaksinen et al., 2002). Описано четыре варианта рецептора (GFR1-4), специфичных к разным белкам .

GFR GDNF

присоединяется к GFR1, а затем образует комплекс с RET. Остальные представители семейства трансформирующих факторов роста, такие как неуритрин (NRTN), артемин (ARTN), персефин (PSPN), взаимодействуют с другими вариантами рецептора GFR .

Неуритрин (NRTN) присоединяется к GFR2, артемин (ARTN)– к GFR3, а персефин (PSPN) активирует RET, взаимодействуя с GFR4 (рисунок 3а). NRTN и ARTN имеют слабое сродство к GFR1, а GDNF в свою очередь к GFR2 и GFR3. GFR рецепторы в обычном состоянии заякорены в мембране, но существуют также свободные формы, образованные разрезанием фосфолипазами или протеазами (Paratcha et al.,2001) (рисунок 3) .

Рисунок 3. Лиганды семейства GDNF и их взаимодействие с рецепторами .

А) Рецептор Ret имеет внеклеточный домен, который содержит цистеин-богатую область, кадгеринподобные домены, трансмембранный домен и внутриклеточный тирозинкиназный домен .

На карбоксильном конце, RET имеет три альтернативных аминокислоты. RET является рецептором для семейства глиального нейротрофического фактора (GDNFs), которое включают в себя: NTRN, ARTN, PSPN. Каждый из этих лигандов взаимодействует с RET через ко-рецептор поверхности клетки, из семейства рецепторов-, GFR, которые состоят из двух-трех глобулярных доменных белков. Данные белки привязанны к клеточной мембране с помощью анкерных «якорей». Б) GFLs не напрямую взаимодействуют с RET .

Они связываются с GFR ко-рецепторами, образуя комплекс гетеродимера, который затем проникает в липидный слой с образованием поддоменов. Лиганд-ко-рецепторный комплекс и конфармационные изменения облегчают взаимодействие RET и мономера, что приводит к процессам димеризации рецептора и автофорфорилированию. (Lois M. Mulligan, 2014) Однако, многое в этих взаимодействиях на данный момент неизвестно. Например, в некоторых клетках и тканях GFRs активно экспрессируются, в то время как RET не обнаруживается (Trupp et al., 1997; Golden et al., 1999). Кроме того, ряд исследователей показали, что GDNF может активировать внутриклеточные сигнальные пути без взаимодействия RET с GFR1 (Airaksinen и Saarma, 2002). Это говорит о возможности существования неизвестного ранее трансмембранного белка-рецептора для GDNF GFR1(Airaksinen и Saarma, 2002). Другое предположение было выдвинуто в работе Paratcha, которое заключается в том, что рецепторные комплексы могут формироваться между RET и GFR рецептором от смежных клеток, или, что комплекс может образовываться с растворимой формой RET. (Paratcha et al., 2001). Кроме того, было показано, что адгезивные молекулы нервных клеток (NCAM) могут также функционировать как сигнальный рецептор для GFLs (Paratcha et al., 2003). Позже было показано, что комплекс GFLs и GFRs может образовываться не только с RET или NCAM, запуская, таким образом, соответствующие пути (Ledda et al., 2007), но и с другими белками, запуская, например, регуляцию дифференцировки и миграцию незрелых кортикальных GABAэргических нейронов (Pozas и Ibez, 2005). Механизмы этих RETнезависимых сигнальных путей плохо изучены .

В ряде работ были исследованы соотношения распределения GDNF и его рецепторов в клетках головного мозга млекопитающих. Так в работе Clara Ortega-de San Luis с соавторами в 2016 году был проведен подробный анализ локализации GDNF и его рецептора GFR1 в мозге мышей с использованием метода конфокальной микроскопии. В ходе исследования было показано, что GFR1 преимущественно экспрессируется в нейронах, однако, авторы работы обнаружили небольшую экспрессию GFR1 и в клетках не нейронального происхождения .

При этом было показано, что у новорожденных мышей экспрессия GFRa1 была значительно выше, чем у взрослых животных. Авторы работы обнаружили, что на всех стадиях развития организма экспрессия GDNF в мозгу была всегда ощутимо ниже, чем экспрессия его рецептора GFR1 (Ortega-de San Luis C, et al., 2016). То, что концентрация GDNF в клетках мозга млекопитающих очень небольшая было показано и раньше в работе d’Anglemont de Tassigny (d’Anglemont de Tassigny et al., 2015). Ortega-de San Luis C (Ortega-de San Luis C, et al., 2016). показал соотношение рецептора и фактора в клетках мозга. Ряд отделов мозга, например, мозжечок, черная субстанция, обладают значительными концентрациями GDNF и GFR1, однако, преобладание концентрация всегда сохраняется. Если анализировать GFR1 функциональную значимость GDNF и GFR1 в эмбриогенезе и в процессах, происходящих во взрослом организме, то можно сказать, что на данный момент не обнаружена корреляция между повышенной экспрессией GDNF и GFR1 и развитием эмбриона. Пока известно лишь, что генетический дефицит либо лиганда либо рецептора, не приводят к очевидным аномалиям эмбриона. У взрослых особей млекопитающих показано, что снижение концентрации GDNF снижает обучение и память (Gui L et al., 2017). Таким образом, на данный момент показана значимая роль сигналов GDNF у взрослых особей в большей степени, чем во время эмбриогенеза. (Ortega-de San Luis C et al., 2016) .

2.2. Характеристика GFR рецепторов

Известны четыре GFR рецептора: GFR1 (Jing et al., 1996; Treanor et al., 1996), GFR2 (Baloh et al., 1997; Buj-Bello et al., 1997; Klein et al., 1997; Suvanto et al., 1997), GFR3 (Jing et al., 1997; Baloh et al., 1998; Masure et al., 1998; Naveilhan et al., 1998; Nomoto et al., 1998; Trupp et al., 1998; Widenfalk et al., 1998; Worby et al., 1998) и GFR4 (Thompson et al., 1998; Masure et al., 2000; Lindahl et al., 2000) (рисунок 3) .

GFR белки имеют разные аффинности разным GFL факторам, что определяет определяет специфичность связывания лигандов семейства GDNF. GDNF, NRTN, и ARTN специфически связываются соответственно с GFR1, GFR2 и GFR3. PSPN не связывается ни с одним из этих рецепторов, но связывается с белком GFR4 .

Рецепторы GFR состоят из около 400 аминокислот и содержат три Nгликозилированных сайта. Молекулярный вес GFR1 в отсутствии гликозилирования составляет около 47 кДа (Jing et al., 1996). Несмотря на то, что GFL имеют значительное сходство в строении с белками TGF- семейства, GFR рецепторы мало схожи с рецепторами семейства TGF-. GFR рецепторы лишены множества доменов обычно присутствующих в других рецепторах, таких как лейциновые повторы, иммуноглобулин и фибронектин-подобные домены, (Scott и Ibez, 2001) .

Установлено, что GFR рецепторы богаты цистеином (Jing et al., 1996). На данный момент определено, что GFR рецепторы состоят из трех гомологичных цистеиновых доменов (пронумерованные 1-3 от начала N-конца). Домены 2 и 3 локализуются очень близко, в то время как домен 1 отделен от домена 2 довольно длинным и гибким петлевым участком (Leppnen et al., 2004). Домены 2 и 3 присутствуют во всех GFRs, а вот наличие домена 1 непостоянно, например, он отсутствует у куриного GFR4 (Lindahl et al., 2000;

Masure et al., 2000; Lindahl et al., 2001) .

Благодаря GPI-якорю GFR рецепторы локализуются в липидных слоях на цитоплазматической мембране клетки, но это прикрепление может быть нарушено, и в таком случае образовывается растворимая форма GFRs. Растворимый GFR1 также связывается с GDNF и может взаимодействовать с двумя молекулами RET, что способствует гомодимеризации и автофосфорилированию рецептора (Jing et al., 1996) .

В статье, Lindahl с соавторами в 2001 году в экспериментах in vitro, было продемонстрировано, что растворимая изоформа GFR4 может связываться с RET и вызывать его фосфорилирование. Растворимая изоформа GFR4 млекопитающих может активировать RET независимо от наиболее предпочтительного лиганда - персефина .

(Lindahl et al., 2001). Кроме того, данная изоформа вызывает передачу сигналов, а также выживание нейронов и их дифференцировку, в отсутствии персефина. (Lindahl et al., 2001) .

В 2001 году Paratcha c соавторами продемонстрировали, что растворимые молекулы GFR1 могут связываться с GDNF во внеклеточном пространстве и обнаруживаться в транс-изоформе в c-RET экспрессирующих нейронах. Данные межклеточные контакты играют важную роль в GFLs сигналинге. In vivo растворимый GFR1 выделяется нейронами энтеральной нервной системы (ENS), Шванновскими клетками, а также поврежденым седалищным нервом. В данной работе было показано, что GFR1 в межклеточном пространстве может участвовать в процессах межклеточных взаимодействий. Оказалось, что не только GPI-закрепленные, но и растворимые рецепторы GFRa1 опосредуют включение с-RET в липидные рафты. Стимуляция экзогенным GFRa1 продлевает присутствие и активацию с-RET в липидных рафтах .

Нейроны, посеянные на иммобилизованный GFRa1 и стимулированные GDNF, образовывали аксональные выросты с очень крупными конусами роста что приводило к образованию крупных ламеллиподий. Авторы предполагают, что GPI-закрепленный GFRa1 может быть высвобожден под действием мембранных фосфолипаз или протеаз .

Растворимые молекулы GFRa1 могут захватывать GDNF во внеклеточном пространстве и активировать c-Ret на клетках-мишенях. Свободный GFRa1 также может быть иммобилизован во внеклеточном матриксе и презентировать GDNF аксонам, растущим на этом субстрате. Молекулы GFRa1, заякоренные посредством GPI в Шванновских клетках могут связывать GDNF и презентировать его c-Ret на соседних аксонах, стимулируя и направляя их рост (Paratcha et al., 2001) .

2.2.1. Особенности структуры GFRs рецепторов семейства GDNF(GFRs)

Изначально предполагали, что структура GFRs состоит из -спирали и содержат три цистеиновых домена (D1, которые объединены небольшой D2, D3), последовательностью (Airaksinen et al., 1999). Третий домен GFRa находится в тесном контакте со вторым лигандсвязывающим доменом. Они связаны через первый домен на расширенной шарнирной области. GFR4 же отличается, он содержит только домены, аналогичные второму домену и третьему в GFRa1-3. (Bespalov and Saarma, 2007). Затем Scott и Ibez в 2001 (Scott и Ibez, 2001) году предположили, что участок, содержащий домены 2 и 3 на самом деле представляют из себя объединенный домен. Они описали наиболее стабильную для всех рецепторов этой группы лигандную зону, которая расположена в центральном участке GFR рецепторов. Авторы обнаружили, что этот участок включает в себя 4 -спирали и два -тяжа. Домен 1 (N-терминальный домен) является необязательным как для специфического лигандного связывания, так и RET фосфорилирования (Sanicola et al., 1997) и отсутствует в GFR4 (Trupp, et.al., 1998) .

Данный домен участвует в субклеточной сортировке и необходим при взаимодействии с трансмембранными молекулами. (Scott и Ibez, 2001). Домен 3 (D3) формирует узел из пяти -спиралей и с пятью дисульфидными мостами. Три спирали (1, 2 и 4) образуют центральный узел, а ядро узла сформировано гидрофобными остатками этих спиралей .

Первичная кристаллическая структура домена 3 (D3) GFR1 рецептора описана в работе Leppnen (Leppnen et al., 2004). В работе Leppnen было обнаружено 12 консервативных GFR остатков, включающих как D2 и D3, на одной стороне GFR3 и в комплексе, тем самым был определен потенциальный сайт связывания RET. Позднее наличие D2 и D3 в рецепторах GFR, будет названо единым модулем “D2D3"(Wang, 2013) .

Структура домена 3 GFR1 была использована для моделирования гомологичного домена 2 (D2) (Leppnen et al.,2004). Эта модель предполагает, что D2 и D3 являются четко разделенными, что, опровергается предположением Scott и Ibбсez, сделанным в

2001. По их версии, D2 состоит из пяти -спиралей и обладает более компактной структурой, чем D3. Поверхность D2 имеет две большие положительно заряженные области. Одна, из которых расположена в области аминокислот: R224, R225, R217, H207 и K150; а вторая характеризуется гепарин связывающим паттерном в районе 189–197 аминокислотных остатков .

Моделирование процесса связывания GDNF-GFR1 обнаружило использование в этом процессе D3 и D2 (Eketjll et al., 1999; Scott и Ibez 2001). Были обнаружены четыре мутации, которые значительно ослабляют связывание GDNF или отрицательно влияют на RET фосфорилирование (Leppnen et al., 2004). Эти четыре мутации предположительно располагаются в сопряженной системе GFR1-GDNF .

Последние исследования показали, что D2 и D3 разделены, однако совместно образуют компактную глобулярную структуру. Каждый домен состоит из пяти альфаспиралей (1–5 для D2, 6–10 для D3) которые образуют одну треугольную спираль в каждом домене. В работе Wang на примере взаимодействия артемина с его рецептором показано, что кончики цинковых пальцев ARTN контактируют со спиралью, образованной из -спиралей. Таким образом, 16 аминокислотных остатков от ARTN и 19 аминокислотных остатков от GFR3 образуют зону контакта приблизительно в 1500 2 .

Подобная зона контакта, сохранена при взаимодействии всех GFLs и GFR рецепторов (Wang et al., 2006). Wang с соавторами показал, что вышеописанные аминокислотные остатки сохраняются, как основные якоря во всех GFL-GFR парах, изменяются лишь близлежащие специфичные маркеры, которые уникальны для каждой GFL-GFR пары .

Опять же на примере артемина авторы показали, что поверхность GFR3, включающая остатки от спиралей 2, 3, 7, 8, 9 и 10 (от обоих доменов D2 и D3) образует часть RET связывающей поверхности (Wang et al., 2006) .

2.3. Характеристика рецептора тирозинкиназы .

RET – это трансмембранный белок, который имеет четыре кадгерин-подобных повтора во внеклеточном домене и каталитический внутриклеточный домен .

Взаимодействие комплекса GFL- GFR c внеклеточным доменом RET приводит к активации каталитического домена рецепторной тирозинкиназы (Airaksinen, Saarma, 2002). Согласно классической модели, димер GDNF присоединяется к мономерному или димерному GFR1, и далее этот комплекс взаимодействует с двумя молекулами RET, способствуя гомодимеризации и фосфорилированию рецептора (Airaksinen et al., 1999) .

Однако, GDNF с мутациями, затрудняющимим его связывание с GFR1, сохраняют способность связываться и активировать RET на нормальном уровне. Эти данные подтверждают роль c-Ret в связывании лиганда и указываютна то, что GDNF не инициирует образование рецепторного комплекса, а скорее взаимодействует с уже собранным комплексом GFR1-c-Ret (Eketjll et al., 1999) .

RET - рецептор тирозинкиназы может функционировать, как рецептор для фактора роста, так и, в случае мутаций, может запускать каскады, связанные с онкологическимим процессами, и, таким образом, может являться онкогеном. В норме RET, экспрессируется в процессе эмбриогенеза млекопитающих, в том числе и человека, в тканях выделительной системы, периферической нервной системе и в мото и катехоламинэргических нейронах центральной нервной системы. (Pachnis et al., 1993;

Avantaggiato et al., 1994; Durbec et al., 1996). Во взрослом организме, RET экспрессируется в некоторых типах нейрональных клеток и хромаффиных клетках мозгового слоя надпочечников (Nakamura et al., 1994). Мутации в гене RET или нарушения в сплайсинге приводят к ряду серьезных заболеваний, в том числе и к онкологии. Также по ряду исследований выдвинуто предположение, что RET может функционировать в отсутствии GDNF как зависимый рецептор, который включает апоптоз (Bordeaux et al., 2000) и как утверждается в работе Caibano в определенных условиях, предотвращает рост опухоли (Caibano et al., 2007) .

GFR рецепторы заякорены в мембране через GPI. (Airaksinen et al., 2002) .

Присоединение GDNF к GFR1 приводит к привлечению RET в липидный рафт .

Взаимное расположение комплекса GDNF- GFR1 и RET в рафте служит триггером различных внеклеточных и внутриклеточных сигнальных путей. При этом происходит активация разных сайтов фосфорилирования RET .

Ряд исследователей показали, что сигнальный путь может быть использован без задействования RET. Расщепление мембранными фосфолипазами переводит GFR в растворимую форму. (Paratcha et al., 2001). Данное явление носит название "транс" сигнализация. Оно объясняет, почему GFR ко-рецепторы экспрессируются многими клетками и тканями в отсутствие RET и могут, таким образом, выполнять внеклеточные автономные функции (Paratcha и Ledda, 2008; Ibanez, 2010). Транс сигнализация может также иметь терапевтическое применение. Растворимая форма GFR1 может быть рассмотрена, как продукт необходимый для поддержания жизнеспособности дофаминэргических нейронов во время нормального процесса старения. (Pruett and Salvatore, 2013). В последних работах было показано физиологическое значение сигнализации in vivo в липидных рафтах, посредством GFR1/RET в естественных условиях (Tsui et al., 2015) .

RET синтезируется как не фосфорилированный мономер, однако, в комплексе с GDNF- GFR1 участвует две фосфорилированные молекулы RET. Исходно молекулярный вес RET 120 kDa (Takahashi et al., 1992). Процессы гликолизирования в аппарате Гольджи увеличивают молекулярный вес зрелого RET до 170 kDa. В связи с альтернативным сплайсингом RET экспрессируется в нескольких изоформах (Tahira et al., 1990; Lorenzo et al., 1995; Ivanchuk et al., 1997). Две наиболее изученные изоформы отличаются своими последовательностями с С-конца. Они имеют N-концевую последовательность в 1063 аминокислот. Короткая изоформа (RET9) содержит C-последовательность, состоящую из 9 аминокислот, таким образом, целый белок состоит из 1072 аминокислот. Длинная изоформа RET (RET51) имеет хвост из 51 аминокислоты и в сумме представлена белком размером в 1114 аминокислот (Tahira et al., 1990; Lorenzo et al, 1995). RET изоформы различно экспрессируются в эмбриональных тканях и тканях взрослого организма млекопитающих, что было показано на примере мышей в работе Lee (Lee et al., 2003) .

Методом RТ-PCR было показано, что RET9 приоритетно экспрессируется в эмбриогенезе (Yoong et al., 2005). В работе Graaff показано, что изоформа RET9 играет значимую роль в развитии почек и энтеральной нервной системы у мышей (deGraaff et al., 2001). В другой работе Pierchala доказано, что RET51 активно участвует в метаболизме и росте симпатических нейронов у взрослой крысы, при этом резко снижается экспрессия короткой формы RET9 (Pierchala et al., 2006). Однако в тоже время обнаружено, что гиперэкспрессия RET51 может способствовать значительному разрастанию опухоли и развитию ассоциированной с ней же мультикомплексной эндокринной неоплазии 2 (MEN 2) (Asai et al., 1996). Интересно то, что тирозиновый остаток Tyr1062, который фосфорилируется в процессе активации RET, функционирует как адаптационный белок .

Tyr1062 находиться прямо перед C-концевым остатком, который является общим для обеих изоформ (Wong et al., 2005). В отличие от RET9, RET51 имеет два дополнительных тирозиновых остатка, Tyr1090 и Tyr1096, которые могут принимать участие в сигнальном пути (Lorenzo et al., 1997; Alberti et al., 1998; Borrello et al., 2002) .

2.3.1. Особенности структуры RET

Полная структура RET не изучена до сих пор. Обнаружено, что внутриклеточная доменная структура существует как в нефосфорилированной, так и фосфорилированной вариации .

Опираясь на данные молекулярного моделирования был сделан вывод, что зрелая форма RET включает четыре кадгеринподобных домена (число остатков 29-516), цистеинбогатый домен (остатки 517-635), трансмембранный домен (число остатков 636-657), примембранный домен (число остатков 658-723), киназный домен (число остатков 724и C-терминальный хвост (Anders et al., 2001; Runeberg-Roos и Saarma, 2007).Доменная структура RET имеет сходство с другими RTKs, однако RET и значительно от них отличается наличием четырех кадгерин-подобных доменов (CLDs) (Anders et al., 2001). Кадгерин нуждается в кальции для функционирования: такое связывание с ионами кальция линеализирует молекулу и придает ей жесткость, стимулируя тем самым димеризацию, кроме того, подобное связывание защищает кадгерин от протеолитической деградации (Nagar et al., 1996). Таким образом, связывание кальция с кадгеринподобным доменом RET белка может индуцировать линеаризацию и жесткость всего внеклеточного участка RET, и стимулировать димеризацию (Anders et al., 2001). Обнаружено, что кальций является необходимым условием для правильной упаковки RET (vanWeering et al., 1998) и его лиганд-индуцируемой активности (Nozaki et al., 1998). Kjaer и Ibez предположили, что первые три N-концевых кадгерин подобных домена человеческого RET содержат лиганд связывающие поверхности, точно такие же, как связывающяя поверхность GFR1, которая локализуется на первом N-концевом кадгеринподобном домене (Kjaer и Ibez, 2003) .

Четвертый же CLD4 домен и цистеин-богатый домен (CRD) необходимы для связывания RET с GFR1/GDNF, так как RET рецептор не способен связываться с GDNF в отсутствии GFR1 (Amoresano et al .

, 2005). Цистеин-богатый домен локализован около четырех кадхеринподобных доменов и состоит из 117 аминокислот. Вообще в составе RET обнаружено 28 цистеиновых остатков, которые присутствуют в его внеклеточном домене. При этом наличие цистеиновых остатков весьма консервативно у млекопитающих, например, у человека и мыши обнаруживается гомология по 27 цистеиновым остаткам (Takahashi et al., 1989). В работе Asai утверждается, что цистеиновые остатки включены в образование внутризвеньевых дисульфидных мостов, которые способствуют формированию третичной структуры RET белка (Asai et al., 1995) .

В более поздней работе Asai показано, цистеин-богатый домен принимает участие в GFRсвязывании (Asai et al., 2006). Следующий, описанный в структуре RET домен – трансмембранный. Трансмембранный домен участвует в нековалентном RET взаимодействии между двумя RET молекулами и может способствовать гомодимеризации RET (Kjaer et al., 2006). Упомянутый выше, внутриклеточный примембранный домен локализован прямо между клеточной мембраной и киназным доменом. Таким образом, он напрямую задействован в сигнальном пути RET. В экспериментах in vitro показано, что тирозиновый остаток Tyr687 в этой части RET необходим для обеспечения процесса фосфорилирования (Liu et al., 1996). Tyr687 учавствует в модуляции RETкиназного пути посредством циклического аденозин-3’5’-монофосфата (cAMP) (Fukuda et al., 2002) .

Кроме того было обнаружено, что для активации RET киназного пути необходимо фосфолирирование также и Ser696 посредством протеин киназы А. При изучении нокаутных животных по аналогу с человеческим Ser696 (S697A) было обнаружено, что Ser697 необходим для образования векторного разрастания отростков энтеральных нейрональных клеток при развитии кишечника в эмбриогенезе, S697A мутация приводила к отсутствию энтерической нервной системы в дистальной толстой кишке (Asai et al., 2006) .

Внутриклеточная часть RET представлена в основном киназным доменом .

(Knowles et al., 2006). RET киназный домен состоит из малого N-субдомена, состоящего из аминокислотными остатками в области 713-805, и большого C-субдомена, расположенного в области 812-1013 аминокислотных остатков, соединенных линкером .

Оканчивается RET C-терминальным хвостом, длина цепи которого отличается в различных сплайсинговых вариантах RET .

2.4. Образование GDNF-GFR-RET комплекса В комплексе с рецептором GFR лиганды GDNF приобретают высокое сродство к RET. Дальнейший путь передачи сигналов комплексом GDNF/GFR1/RET имеет характерные особенности рецептора тирозин киназ, в том числе активацию Ras/MAP киназы (Ibanez, C.F., 2013). Сигнал GFLs распространяется в клетке с участием RET рецептора тирозин киназы, и с помощью GFRs, которые связывают GFL. Эти составляющие образуют сигнальный комплекс на клеточной поверхности. GFL-GFRRET комплекс состоит из димера GFL и двух молекул GFR, связанных с двумя молекулами RET. В соответствии с изначальной моделью, исходное формирование комплекса GDNF-GFR-RET представляет собой связывание димерного GDNF с GFR1, причем это связывание происходит в равной степени как с димерной так и с мономерной формой. GDNF-GFR1 комплекс далее взаимодействует с двумя молекулами REТ, таким образом включая их гомодимеризацию и автофосфорилирование (Jing et al., 1996). Другие члены GFL взаимодействуют со своими GFRs ко-рецепторами и активируют RET по такому же механизму, как и GDNF. Однако ясное и четкое представление об образовании этого комплекса пока отсутствует. По одной из версий GFL и GFR вместе образуют связывающую поверхность для RET, по другой версии связывающийся GFL изменяет конформацию GFR, образуя тем самым связывающий сайт для RET. В этих моделях, GFR и RET не могли бы связаться друг с другом в отсутствие GFLs. С другой стороны, возможно, что мономерные GFR и RET формируют пре- ассоциированный комплекс с каждым GFLs, способный позже связаться. Формирование комплекса могло происходить тремя различными путями (рисунок 3): 1) GFL2 (GFL гомодимер) сначала связывается с GFR, получившийся комплекс связывает второй ко-рецептор, а GFL2-GFR2 - две молекулы RET. 2) после связывания GFL2 с GFR, одна молекула RET задействуется, а после задействуется второй мономер GFR и RET с GFL2-GFR-RET комплекс 3) GFL2 связывается с пре-ассоциированным GFR-RET гетеродимером и задействует GFR-RET пару 4) В результате GFL2 связывания, пре-ассоциированный GFR2-RET2 тетрамер подвергается конформационным изменениям и активируется .

Различные взгляды на структуру и кинетику GFL/GFR/RET комплекса были обоснованы в частности спорными результатами изучения взаимодействий между участниками комплекса. Jing с соавторами (Jing S. еt al., 1996) предложил, что RET не включен в инициальное связывание GDNF с комплексом. Однако было показано, что в присутствии влияния GFR1 эти две молекулы оказываются тесно сближены в комплексе GFL/GFR/RET (Trupp et al., 1996; Amoresano et al., 2005). Существует также преассоциация между GFR1 или GFR2, и RET (Sanicola et al., 1997; Treanor et al., 1996) .

Факт, что некоторые мутантные формы с пониженной способностью GDNF взаимодействовать с GFR1 все же могут нормально активировать RET в присутствии GFR1, что говорит о том, что существует заранее сформированный GFR1/RET комплекс, который обладает более высоким сродством к GDNF, чем отдельно взятые GFR1 или RET (Eketjll et al., 1999). В итоге, Cik с соавторами (Cik et al., 2000) обнаружил высокую способность GDNF-связывающего сайта на GFR1 только в присутствии RET. Tansey с соавторами (Tansey MG et al., 2000) показали, что RET не образует иммунопреципитат с GFR ко-рецепторами в отсутствии лиганда. Множество рецепторов тирозин киназы активируются, когда два рецептора мономера сведены вместе и, таким образом, подвергаются воздействию трансфосфорилирования. Однако в некоторых биохимических и структурных исследованиях с димеризированными рецепторами, было обнаружено, что только часть димеров имеет такие конформации, которые могут принимать участие в транс-автофосфорилировании и стимулировании белков сигнального пути (Lemmon и Schlessinger, 1994). Димеризация не всегда обязательна для активации. Считается, что мономер рецептор находится в равновесии с димером рецептором, и что активные димеры существуют даже в отсутствии лиганда .

Лиганд, связывающийся с внеклеточным доменом рецептора, стабилизирует образование устойчивых димеров и, следовательно, запуск сигнального пути (Schlessinger 2000). В модели, предложенной Беспаловым и Саарма равновесие устанавливается между мономерами RET и GFR, неактивными и активными формами RET димеров и неактивными GFR2-RET2 гетететрамерами. В результате связывания лиганда, равновесие может быть сдвинуто в сторону активных димеров. Другой способ сдвинуть равновесие в сторону предварительно сформированных димеров RTK состоит в увеличении плотности концентрации количества рецептора на поверхности клетки (Bespalov и Saarma, 2007) .

В ряде работ было показано, что GDNF способен активировать внутриклеточные сигнальные пути независимо от RET, посредством рецептора GFR1. В RET-дефицитных клеточных линиях и первичных нейронах, GDNF запускает SFK активацию и впоследствии фосфориляцию MAPK, PLC-, белка, связывающегося с cAMP элементом – CREB, включая индукцию C-FOS. Подобный путь может быть активирован в условиях патологического процесса, например при раковых заболеваниях (Pezeshki et al.,2001) .

3. Влияние GDNF на нейральные клетки

Глия-производный нейротрофический фактор (GDNF) способствует выживанию и влияет на пролиферацию, миграцию и дифференцировку ряда нейронных популяций в пределах центральной и периферической нервной систем (Airaksinen и Saarma, 2002;

Enomoto, 2005; Paratcha и Ledda, 2008). В основном его влияние распространяется на те типы нейрональных клеток, которые характеризуются сигнальными путями через образование гетеродимерного комплекса, состоящего из GDNF с GFR1 и RET. GDNF экспрессируется как нейронами, так и астроцитами (Lin et al., 1993; Marco et al., 2002;

Nicole et al., 2001; Schaar et al., 1993). Усиление синтеза GDNF астроцитами предположительно связано с повышением выживаемости нейронов и процессами пластичности после ишемии (Miyazaki et al., 2001; Tokumine et al., 2003) и повреждений, вызванных эксайтотоксичностью (Ho et al., 1995; Marco et al., 2002). In vivo GDNF, вырабатываемый астроцитами, оказывает протекторный эффект на дофаминэргические и мотонейроны (Parsadanian et al., 2006; Zhao et al., 2004; Cunningham и Su, 2002; DoThi et al., 2004; Ericson et al., 2005). Эндогенный GDNF отвечает за когнитивные способности .

Показано, что мутантные мыши, гомозиготные по делеции в гене GDNF, хуже обучались пространственным навыкам (Gerlai et al., 2001). В процессах пространственного обучения задействован гиппокамп .

Возможно, данная делеция влияла на развитие этой структуры, тем самым нарушая способность мыши к обучению. При этом показано, что при нормальном старении и не патологическом уменьшении количества нейронов в гиппокампе также происходит ухудшение пространственного обучения (Broadbent et al.,2004). Однако при нормальном старении было обнаружено, что нейротрофины (Fischer et al., 1994; Martnez-Serrano et al., 1996), холинергические препараты (Bontempi et al.,2003) и антиоксиданты (Levin et al., 2002; Nishiyama et al., 1997) способны предотвращать гибель нейронов гиппокампа, и тем самым, улучшают память, чего не наблюдается при вышеупомянутой делеции и нарушении в процессах эмбриогенеза. Роль GDNF в этом процессе не ясна до конца. Однако, в работе Nielsen 2009 года (Nielsen et al.,

2009) был представлен статистический анализ, направленный на исследование влияния GDNF на первичную культуру нейронов гиппокампа, полученную из 19 дневных эмбрионов крыс. Удивительно, что в этой культуре не была обнаружена экспрессия RET (Nosrat et al., 1997; Yu et al., 1998; Golden et al., 1999; Kiryushko et al., 2003). Поэтому данное исследование не только демонстрирует влияние GDNF на дифференцировку нейронов, но и доказывает другой, альтернативный путь активации GDNF, посредством NCAM. Данный эффект был доказан с помощью метода Вестерн-блот гибридизации .

Показано, что нейроны гиппокампа 19 дневного эмбриона крысы не экспрессируют RET, но активно экспрессируют NCAM и корецептор GFR1 (Nielsen et al.,2009). Итак, в этой работе представлена способность GDNF индуцировать нейриты, что оценивали путем инкубации нейронов с различными концентрациями GDNF в течение 24 часов. GDNF вызвал увеличение аксонов в культуре нейронов выращенных на подложке, обработанной этим нейротрофическим фактором (Nielsen et al.,2009). Статистический анализ показал, что эффект GDNF был статистически значимым (F (5,48) =7,78; р0,0001). Максимальный эффект GDNF, наблюдался при использовании концентрации GDNF 0,3 нМ (10 нг / мл) и равнялся примерно 175 %-ному увеличению нейритов по отношению к контролю. Также были проведены тесты с использованием более высоких концентраций от 0,03 до 1,7 нМ GDNF, которые также показали, что количество нейритов в опыте значительно превышало их количество в контрольных культурах и авторами был сделан вывод о том, что GDNF в растворе может вызывать рост аксонов нейронов гиппокампа. (Nielsen et al.,2009) .

В недавних работах продемонстрированно, что GDNF оказывает различное влияние на аксоны мотонейронов, в отличие от его влияния на клеточное тело мотонейронов. (Zahavi et al., 2015). На крысиной модели бокового амиотрофического склероза (БАС), показано, что GDNF способствует увеличению продолжительности жизни животного и улучшению анамнеза заболевания. (Krakora et al., 2013). Эксперименты, Sergaki совместно с Ibanez (2017) по изучению влияния GFR1 на миграцию клеток Пуркенье показали, что GFR1 временно экспрессируется в развивающихся клетках Пуркенье. Потеря GFR1 приводит к задержке миграции данных клеток. Ни GDNF, ни RET, не вносят вклад в процесс миграции. Вместе с тем молекулы нейрональной клеточной адгезия экспрессируются совместно и непосредственно NCAM взаимодействует с GFRa1 в эмбриональных клетках Пуркенье. Генетическое снижение экспрессии NCAM усиливает миграцию дикого типа клеток Пуркенье и восстанавливает миграцию в клетках мутантных по гену GFR1, указывая, тем самым на способность NCAM ограничивать миграцию клеток Пуркенье в эмбриональном мозжечке .

Эксперименты in vitro показали, что GFRa1 может функционировать как в цис так и в транс форме, тем самым противодействовать NCAM и содействовать миграции клеток Пуркинье. Таким образом, исследования показывают, что GFR1 способствует миграции клеток Пуркенье посредством ограничения функции NCAM (Maria Sergaki and Ibanez, 2017)

4. Возможные способы применения GDNF в клинике .

С момента своего открытия GFLs привлекали внимание как потенциальные терапевтические агенты для лечения некоторых неврологических заболеваний. В работе Santos с соавторами был проведен сравнительный анализ оптимальных доз различных представителей нейротрофических факторов (GDNF, FGF-2, NGF, NT-3 и BDNF) для стимуляции моторной и сенсорной регенерации аксонов в экспериментах in vitro и in vivo. Самые эффективные нейропротекторные свойства продемонстрировали GDNF и FGF-2, причем эти активность этих факторов была позитивна как для стимуляции образования отростков моторных нейронов, так и сенсорных нейронов. NGF и NT-3 демонстрируют стимулирование сенсорного роста нейритов в экспериментах in vitro, однако, данное стимулирование теряется в модели in vivo. И, наконец, нельзя не отметить действие BDNF, который в выбранных дозах стимулирует рост аксонов в обеих моделях in vitro и in vivo. (Santos D et al., 2016). В тоже время, ряд исследователей обращает внимание на рецепторы нейротрофических факторов, как на потенциальные терапевтические средства. Так, например, было показано, экспрессия рецептора GDNF GFR1 может иметь решающее значение для поддержания нормальной функции нейронов, аналогично влиянию самого GDNF. В культуре клеток корковых нейронов, полученных от пациентов с болезнью Альцгеймера, наблюдается снижение уровня GFR1, а его повышение благоприятно сказывается на состоянии клеток. (Konishi Y, et al., 2014). Таким образом, можно рассматривать как терапевтическое средство как GDNF, так и GFR1. Еще один аспект важный для терапии, это определение концентраций необходимых для регулировании различных биологических процессов. (C. M. Madl and S .

C. Heilshorn, 2015.) Ниже приводятся некоторые результаты недавних исследований, иллюстрирующих потенциал применения GFLs в клинике. Побочные эффекты, такие как потеря веса и возможность опухолевых новообразований, могут быть устранены посредством локальной доставки нейротрофов (Meng, 2000) .

1) Заболевания, связанные с нарушением двигательных нервов .

При аксотомии седалищного нерва рецептор GFR1 выделяется из шванновских клеток в межклеточную среду в свободной форме. Собственного вырабатываемого GDNF оказывается недостаточно, а введение экзогенного GDNF обеспечивает долговременное выживание нейронов и восстановление аксонов после различных повреждений как у новорожденных, так и у взрослых организмов (Hottinger et al., 2000). Вопрос дальнейших исследований, может ли GDNF, связывающийся со свободным GFR1 способствовать регенерации мотонейронов .

2) Нейропатические боли .

Повреждение нейронов периферической нервной системы обычно ведет к хроническим нейропатическим болям. Как правило, при таком заболевании возникают нарушения в сенсорных проводящих путях. В лабораторных условиях на модели нейропатической боли было доказано участие нейротрофических факторов, их блокировка антителами приводила к уменьшению гипералгезии (аномально высокой чувствительности организма к болевым стимулам) (Zhou et al., 2000). Группа ученых во главе с McMahon показала, что экзогенное введение GDNF может предотвращать некоторые постаксотомические изменения сенсорных нейронов. В ответ на травмы периферических нервов, RET-экспрессирующие сенсорные нейроны разрастаются отростками вокруг других сенсорных нейронов. (Li et al., 2003). Важно отметить, что в моделях нейропатической боли при интратекальном введении (под оболочки спинного мозга) наблюдается обезболивающий эффект, в частности происходит GDNF восстановление работы Na+-каналов. (Boucher et al., 2000). Поврежденные аксоны сенсорных нейронов периферической системы способны нормально восстанавливаться, но не могут достигнуть своей главной мишени – спинного мозга. Постоянное интратекальное введение GDNF может преодолеть это: при травмах дорсального корня спинного мозга введение GDNF приводит к восстановлению строения и функций сенсорных нейронов, они формируют правильные функционирующие контакты с клетками-мишенями (Ramer et al., 2000). Еще больший эффект может быть получен при введении комбинации из GFLs и свободных форм рецепторов GFR. Тем не менее, нужно учитывать сложные взаимодействия, которые могут возникнуть между компонентами. Например, сигналинг с участием GFR3 может ингибировать сигналинг с GFR1 и GFR2, как было показано in vitro на модели постнатальных сенсорных нейронов (Bennett et al., 2000) .

Экспрессия GFR1 может иметь решающее значение для поддержания нормальной функции нейронов, аналогично влиянию GDNF. Недавно было показано, что снижение экспрессии GFR1 наблюдается при болезни Альцгеймера. В культуре клеток корковых нейронов, полученных от пациентов с болезнью Альцгеймера, также наблюдается снижение уровня GFR1 рецептора. (Konishi Y, et al., 2014) .

3) Ишемия .

В экспериментальных моделях локальной ишемии экзогенное введение GDNF до или сразу после аноксии способствовало значительному уменьшению ишемических повреждений головного мозга. Во взрослом организме наблюдается сильный ответ на введение GDNF, так как у нейронов переднего мозга после ишемического инсульта резко возрастает количество RET и GFR1. Интересен тот факт, что в культурах нейронов коры больших полушарий введение GDNF не способно предотвратить апоптотическую гибель клеток, но способно предотвратить некроз, снижая приток ионов Ca2+ через Caопосредованные NMDA-рецепторы (N-метил-D-аспартат) (NicoleO, et al., 2001). Таким образом, GDNF может быть крайне привлекательным терапевтическим препаратом при данном заболевании и вводить его следует сразу после ишемического инсульта .

4) Болезнь Паркинсона .

Многочисленные исследования на животных моделях болезни Паркинсона отмечают благотворное влияние введения GDNF для выживания нигростриатальных дофаминэргических нейронов. Переносу этих наблюдений в клиническую практику до сих пор препятствуют побочные эффекты, связанные с хронической непрерывной интрастриальной инфузией рекомбинантного GDNF (d’Anglemont de Tassigny et al., 2015) .

Существующие на данный момент способы лечения болезни Паркинсона направлены на устранение симптомов и не приостанавливают разрушение дофаминэргических нейронов среднего мозга. На различных моделях болезни Паркинсона было показано, что GDNF может предотвращать нейротоксически спровоцированную гибель дофаминэргических нейронов и способствует восстановлению их функциональной активности (Grondin et al., 1998). Однако введение GDNF в боковые желудочки головного мозга пациента с болезнью Паркинсона не оказало никакого положительного эффекта и повлекло за собой побочные эффекты, например, потерю веса (Kordower et al., 1999) .

Исследователи ищут различные варианты успешного использования GDNF и по сей день .

В этой области акцент сделан на различные варианты доставки GDNF, таких как: 1) совместное введение GDNF и гепарина, который увеличивает распространение GFLs в ткани мозга; 2) введение новых вирусных векторов, содержащих ген GDNF; 3) введение стволовых нейрональных клеток, которые поддерживают GDNF-продуцирующих постоянный высокий уровень экспрессии GDNF (Kordower et al., 2000; kerud et al., 2001) .

Вопрос правильной доставки GFLs крайне важен, т.к. постоянная доставка GDNF в стриатум не приводит к потере веса и способствует функционально активной иннервации стриатума (Bjrklun et al., 2000). Адресная доставка GDNF провоцирует другую проблему .

Если используются вектора или клетки, продуцирующие данный фактор, то не приведет ли бесконтрольная экспрессия фактора к другим патологиям? Это проблема, которая требует использования регулируемых промоторов. Однако на данный момент понятно, что современные технологии, которые включают в себя как способы контроля экспрессии гена, так и новые средства для доставки GDNF выглядят перспективными для лечения болезни Паркинсона (Zurn et al., 2001) .

В настоящее время векторами, используемыми для доставки генов, могут быть плазмиды или вирусные частицы. Доставка генов с использованием векторов на основе аденоассоциированного вируса (AAV) является широко используемым методом для трансдукции нейронов в головном мозге, особенно из-за его безопасности, эффективности и длительной экспрессии. Кроме того, путем изменения типа промотора, можно влиять на клеточную специфичность экспрессии или уровни экспрессии интересующего белка. В ряде исследований, показана, токсичность аденосодержащих вирусов, несущих ген зеленого флуоресцентного белка (GFP), который часто используют в качестве контроля .

(Albert K et al.,2017) Итак, применение ретровируса, в качестве вектора может приводить к непрерывной интеграции трансгена в геном клеток хозяина и более долговременной экспрессии гена .

Однако обладая рядом преимуществ, подобное встраивание несет и ряд недостатков. А именно – бесконтрольная экспрессия гена и неконтролируемые нарушения в геноме .

Другие вектора не приводят к такой интеграции и применяются для кратковременной экспрессии трансгена. Целью введения векторов, несущих необходимые гены, является поддержание жизнеспособности нейронов и стимуляция нейральной дифференцировки предшественников (Black, 2003). Наше внимание привлек промотор гена hsp70 Drosophila melanogaster, так как для его активации необходимо лишь повышение температуры. В нашей работе мы также будем использовать зеленый флуоресцентный белок GFP, в качестве маркера .

Такая система очень удобна для использования в клеточной терапии, т.к .

температура тела млекопитающих (в том числе и человека) является автоматическим стимулятором промотора белка теплового шока дрозофилы (Корочкин,2000) .

5. Hsp70 промотор, как регулируемая система активации гена

Генетический контроль экспрессии или регуляция действия генов является одной из ключевых проблем современной биологии. Гены должны активироваться в строго определенное время жизнедеятельности организма, и в строго определенное время их активность должна блокироваться. В инициации транскрипции гена важную роль играет промотор.

На процесс регуляции активности промотора оказывает влияние:

строение промоторной области, необходимой для прикрепления транскрипционного комплекса; строение энхансеров и сайленсеров, необходимых для сборки транскрипционного комплекса на промоторе и состояние хроматина, который непосредственно обеспечивает доступность промотора и энхансеров для процесса транскрипции (Назаренко, 2001). Тонкая регуляция экспрессии генов крайне важна не только для правильного развития организма, но и для его функционирования. Особенно важна регуляция «мастер» генов, которые определяют работу всего генетического материала организма. В связи с этим, абсолютно понятно, что использование в генной терапии активных промоторов (например, CMV) может сказываться негативно на жизнеспособности как клетки, так и всего организма. Таким образом, особый интерес представляют промоторы, активация которых происходит под воздействием факторов или изменения температуры .

Регулируемые промоторы имеют большое значение при генной терапии, а также при введении чужеродных генов в клетки млекопитающих (в том числе и человека) .

Особый интерес представляют промоторы, которые активизируются под воздействием температуры, что может быть привлекательным свойством данных промоторов, так как такая активация не нуждается во введении металлов или других активаторов. Один из подобных промоторов – промотор гена hsp70 .

В отдельной клетке ответ на тепловой шок предположительно инициируется присутствием несвернутых и поврежденных белков (LindquistS, CraigEA, 1988;

MorimotoRI, 1998; StringhamEG, Candido, 1993). Однако многоклеточные организмы реагируют на стресс иначе. Например, стресс-ответ не индуцируется, даже если поврежденные белки накапливаются при нейродегенеративных заболеваниях (Хантингтнона и Паркинсона). Таким образом, существует дополнительный контроль ответа на тепловой шок на уровне организма (Prahlad, Morimoto, 2009). Нервная система координирует ответ на стресс отдельных клеток, а также регулирует изменения метаболических процессов в тканях на стадиях развития организма. В данной регуляции особое значение имеет фактор теплового шока (HSF). Так, например, повышенные уровни HSF обнаружены в клетках рака молочной железы и простаты у человека (Tang et al.,2005; Khaleque et al., 2008). Мыши с дефицитом HSF1 меньше подвержены опухолям и более живучи в классической модели химической карциономы кожи и в генетической модели экспрессии онкогенной мутации p53. Похожие результаты получены так же на клеточных линиях рака человека (Dai et al., 2007) .

5.1. Фактор теплового шока (HSF) 5.1.1. Понятие о факторе теплового шока (HSF) Факторы теплового шока HSF являются жизненно необходимыми для обеспечения выживания организма в условиях острого стресса. Наиболее известными представителями являются индуцибельные транскрипционные регуляторы генов, кодирующих молекулярные шапероны и другие стресс-белки (в том числе и белок теплового шока HSP). (Christmann et al., 2013). Белки теплового шока в ответ на воздействие стресса ведут себя как молекулярные шапероны, т.е. относятся к белкам, чья главная функция состоит в восстановлении правильной третичной структуры повреждённых белков, а также образование и диссоциации белковых комплексов. Экспрессия белков теплового шока начинается в ответ на рост температуры или другие клеточные процессы. Параллельно с этим повышение температура не только увеличивает экспрессию HSP белков, но оказывает влияние на фолдинг собственных белков клетки. Шапероны, роль которых выполняют HSP белки участвуют в исправлении потенциального вреда, который возникает из-за неправильного сворачивания белков. (Ellis et al.,1991). С другой стороны, ответ клетки на стресс регулируется, прежде всего, на уровне транскрипции с помощью факторов теплового шока (HSF). (Lis and Wu 1993; Sarge et al.,1993; Voellmy 1994, 1996; Wu 1995) HSF - типичный индуцибельный фактор. Впервые его обнаружили Parker и Wu в 1984 году при изучении ядерных экстрактов D. melanogaster, подвергнутых воздействию высокой температуры. HSF был охарактеризован, как белок, специфически связывающийся с регуляторным сайтом гена hsp70 (Parker et al., 1984, Wu et al., 1984 ). В последующих исследованиях было установлено, что у дрозофилы структура HSF кодируется одним уникальным геном, тогда как у человека, мыши и других высших эукариот, включая и растения, обнаружено целое семейство генов HSF (Morimoto et al.,1994; Wu et al., 1995, Nover et al.,1996). HSF факторы связываются со специфической предпромоторной областью, данная последовательность получила название элемент теплового шока (HSE). В 5'-нетранскрибируемых областях генов hsp70 присутствует различное количество HSE, причем некоторые из них соединены по типу “голова к голове” или “хвост к хвосту” (Sorger, 1991). Данные элементы теплового шока (HSE) необходимы для модуляции активности гена hsp70, которая происходит через связывание с HSE белковыми транскрипционных факторов HSF или HSTF (транскрипционный фактор теплового шока). Такая регуляция позволяет контролировать активность данного промотора, как при тепловом шоке, так и при токсическом воздействии на организм .

(Morimoto 1998, Wu et al. 1995). HSE были охарактеризованы, как повторяющиеся последовательности, состоящие из пяти нуклеотидов, общей формулой: 5'-nGAAn-3’ (Fernandes et al., 1994) .

5.1.2. Классификация факторов теплового шока (HSF)

На данный момент обнаружены четыре фактора теплового шока HSF1, HSF2, HSF3 и HSF4. HSF1, HSF2, HSF4 описаны у млекопитающих, тогда как HSF3 обнаружены только у птиц. До сих пор нет полной ясности в понимании роли и функции каждого из этих HSF факторов. Появляются данные, что разнообразие HSF факторов обеспечивает как специализацию стрессового сигнала, так и дифференциальный контроль скорости транскрипции генов белков теплового шока. Кроме того HSF факторы совместно с другими регуляторными факторами контролируют ответ генетических цепей на клеточный стресс (Morimoto, 1998) .

Харрисон в 1994 году изучил гены HSF и предложил схему их строения. Им было обнаружено, что факторы HSF1, 2, 3 содержат 40% одинаковой последовательности в поворотной спирали ДНК связывающего домена (Harrison et al., 1994; Vuister et al.,1994;

Schultheiss et al., 1996). Одинаковым для всех генов HSF является наличие гидрофобного остатка (HR-A / B), который необходим для формирования активной тримеризованной формы HSF1 (Sorger и Nelson 1989; Clos et al., 1990; Peteranderl и Nelson 1992) (рисунок 4). Кроме того для всех HSF характерен С-терминальный трансактивационный домен (Chen et al., 1993; Green et al., 1995; Shi et al., 1995; Wisniewski et al.,1996). ДНКсвязывающий домен - это основной домен HSF при распознавании гена-мишени. HSF домен существует в форме гомодимера или гетеродимера, а также обладает способностью тримеризоваться (Tanabe et al., 1999). На C-концевом домене HSF находится домен трансактивации (модули AD1 и AD2- отвечают за быстрый и продолжительный ответ на стресс) (рисунок 4). Из HSF факторов, которые экспрессируются у позвоночных, HSF1 функционально аналогичен HSF1 фактору у дрожжей и дрозофилы и выступает в качестве основного стресс-индуцированного фактора транскрипции. (Nakai et al.,1993; Rabindran et al., 1991; Sarge et al., 1991) .

Рисунок 4. Схематическое изображение функциональных областей членов семейства HSF человека, мыши и дрожжей .

Основные области HSFs обозначены: Связывающая ДНК область (DBD), гидрофобные остатки (повторы HR-A и HR-B) и С-терминальный трансактивационный домен (HR-С). HSFs содержат спиральные петли DBD. HSF1–HSF4 содержат Leu (лейцитин) -подобные «застежки» в области HR доменов, которые требуются для гомотримеризации или гетеротримеризации. (kerfelt et al., Nature Reviews Molecular Cell Biology, 2010) .

Известно, что мыши нокаутные по гену HSF1 могут нормально развиваться и достичь зрелого возраста. Однако, полученные фибробласты из HSF1- нокаутных мышей не способны к стресс-индуцированной транскрипции генов теплового шока, что противоречит роли HSF1 в ответ на тепловой шок. (McMillan et al.,1998) .

В отличие от более изученного HSF1, процессы регулирования и роль HSF2 была до конца не охарактеризована. На данный момент обнаружено, что индукция ДНКсвязывающих свойств HSF2 сопровождается процессом перехода от неактивного димерного состояния в активный триммер. Тримеризация HSF2 и ее корреляция с активностью была изучена на ранних стадиях эмбрионального развития мышей, в сперматогенезе у человека, и in vitro на человеческих клетках линии К562 эритролейкемии. (Theodorakis et al., 1989; Sistonen et al., 1992; 1994; Mezger et al., 1994;

Sarge et al., 1994; Rallu et al., 1997). Mathew и Morimoto показали, что HSF2 участвует в процессах дифференцировки развивающегося эмбриона (Mathew and Morimoto 1998) .

В отличие от HSF1, HSF2 является лабильным белком, концентрация которого увеличивается при ингибировании активности протеасом. (Mathew et al., 1998) .

Исследования по определению нуклеотидных сайтов элементов теплового шока (HSE), оптимальных для связывания HSF1 и HSF2 с позволяют предположить, что процесс связывания зависит от количества НSЕ. (Kroeger and Morimoto, 1994). Кроме того, данные исследования указали на возможность того, что HSF1 и HSF2 могут иметь различные гены-мишени, а также обладать различной специфичностью в отношении общих геновмишеней (Leppa et al., 1997; Liu et al., 1997). Было обнаружено, что индуцибельное связывание HSF приводит к изменениям в организации структуры хроматина, которые ассоциированны с 5’-фланкирующей областью генов теплового шока (Wu 1984; Giardina et al., 1992) .

Следующий фактор в классификации HSF3, как уже упоминалось выше, обнаружен только у птиц. Надо отметить, что в клетках птиц активация HSF3, а также HSF1 происходит под действием химического или физиологического стресса. (Nakai et al., 1995;

Tanabe et al., 1997). Обнаружение HSF3, как фактора, который совместно экспрессируется с HSF1 в клетках и тканях цыпленка, дает право предположить, что оба эти фактора были вовлечены в стресс-индуцированную активацию генов теплового шока. (Tanabe et al., 1998). Кроме того, активация HSF3 в ответ на тепловой шок обнаруживается преимущественно при воздействии экстремальных температур (выше 45С0). (Tanabe et al., 1997). При этом было обнаружено, что снижение уровня HSF3 оказывает негативное влияние на активность HSF1. В результате сильно уменьшается ответ на тепловой шок, что приводит к нежизнеспособности клетки после воздействия стресса. (Tanabe et al., 1998). HSF3 также взаимодействует и с другими факторами транскрипции и может быть активирован онкогеном Myb, независимо от стресса, посредством прямого белокбелкового взаимодействия между HSF3 и ДНК-связывающими доменами Myb. (Kanei-Ishii et al., 1997). Взаимодействия между онкогеном Myb и HSF3 дает возможность выявить новые генетически регуляторные пути, которые объединяют события клеточного роста и стресса (Mathew and Morimoto 1998) .

HSF4 представляет собой тример, который связывается с HSE. В 1999 году Nakai выдвинул предположение, что HSF4 может выполнять физиологическую роль в процессе развития. В этой же статье показано, что HSF4 обладает существенной активностью при связывании с непосредственно в период формирования хрусталика у HSE млекопитающих. (Nakai, 1999). Для объяснения роли HSF4 в физиологических процессах, Nakai с соавторами вывели линию мышей с видоизмененным геном HSF4. Было показано, что у мышей этой линии обнаруживаются значительные аномалии хрусталика. (Nakai, 1999). Процесс формирования хрусталика является наиболее показательным в процессе роста клеток и дифференцировки, поскольку ткань хрусталика состоит только из двух популяций клеток. (McAvoy et al., 1999). Однако в более поздних работах было показано, что при дефиците HSF4 у мышей хрусталика эмбриона развивается нормально, однако, после рождения появляются включения в волокнах хрусталика, и развивается катаракта (Fujimoto et al., 2004; Min et al., 2004; Shi et al., 2009). Подобные нарушения характерны, скорее всего, для многих млекопитающих, так как данные изменения и их корреляция с экспрессией HSF4 была подтверждена и для человека. Мутации в HSF4 с большой вероятностью ведут к унаследованию катаракты у человека, что было показано в работе Bu с соавторами. (Bu et al., 2002). Было показано, что HSF4 преимущественно экспрессируется в тканях мозга и легких, в отличие от HSF1 и HSF2, которые обнаруживаются в большинстве тканей (Tanabe et al., 1999) .

Для функционирования организма имеет значение, также образование комплексов между факторами теплового шока для функционирования организма. Так, например, комплекс HSF1 и HSF4 необходим для правильного развития сенсорных органов, в постатальный период у мышей при внешнем неблагоприятном воздействии окружающей среды. (Fujimoto et al., 2004).

Надо отметить, что HSF1 и HSF4 вместе контролируют закладку трех главных сенсорных органа головы, названных черепными плакодами:

обонятельная плакода (дает начало обонятельному эпителию), хрусталиковая плакода (дает начало линзе глаза), и ушная плакода (дает начало внутреннему уху) (Gilbert, 2003) .

5.2. Основные характеристики промотора hsp70 5.2.1. Этапы регуляции промотора hsp70 Все организмы отвечают на воздействие окружающей среды посредством активации генов. Механизмы данного ответа регулируются, как молекулярными шаперонами, так и белками теплового шока (HSPs). Нами будет рассмотрен механизм ответа на воздействие теплового шока (HSR), что так же можно охарактеризовать, как состояние стресса. (Lindquist и Craig, 1988). Наиболее изученным примером быстрого и оперативного ответа на стресс, являются HSP70 белки. (Theodorakis и Morimoto, 1987;

Lindquist и Craig, 1988; Cuesta et al., 2000). Механизм быстрой и синхронизированной реакции на температурное воздействие остается неизвестным, но удивительным, поскольку после стресса большинство других генов подавляется на уровне транскрипции, экспорта РНК и трансляции. (Laroia et al., 1999; Mariner et al., 2008). В клетках млекопитающих HSR регулируется на уровне транскрипции фактором теплового шока 1 (HSF1). (Guertin и Lis, 2010; Anckar и Sistonen, 2011) .

При нормальных условиях развития многоклеточного организма, активность мономера HSF1 подавлена и он находится в неактивном состоянии в цитоплазме. HSF1 проявляет высокую афинность к ДНК в форме тримера, данный эффект характерен для всех HSF-эукариот. (Baler et al., 1993; Sarge et al., 1993). Исследования in vitro проведенные в 2006, показали, что для повышения связывания HSF1 c ДНК необходим трансляционный фактор элонгации eEF1A, который содержит последовательность HSE элементов. (Shamovsky et al., 2006) .

После воздействия стресса HSF1 быстро тримеризуется и приобретает способность связывать HSЕ. (Baler et al., 1993; Sarge et al., 1993; Guertin and Lis, 2010; Anckar and Sistonen, 2011), а также активирует РНК-полимеразу-2 (RNAP-2) посредством киназного комплекса (CTD kinase P-TEFb) (Park et al., 2001; Ni et al., 2004; Shen et al., 2009) и реконструкции хроматинового комплекса SWI/SNF (Corey et al., 2003) .

В работе на клетках линии MDA-MB231 (Maria Vera et al., 2014) было продемонстрировано, что HSF1 в отсутствии стрессовых воздействий локализуется в ядре клеток. В клеточных культурах с нокдауном по гену eEF1A, было обнаружено снижение связывающей активности HSE и соответственно низкий уровень связывания HSF1 с HSE, что приводило к снижению активации промотора hsp70. Было выдвинуто предположение о необходимости взаимодействия eEF1A и HSF1 для регуляции активации промотора hsp70 при стрессовых воздействиях на организм (Vera M. et al., 2014) (рисунок 5) .

Рисунок 5. Цикл экспрессии мРНК HSP70 от процесса транскрипции до трансляции в присутствии eEF1A1 .

Данный рисунок обобщает результаты исследования причастности eEF1A1 на этапах индукции HSP70. До стресса, eEF1A1 находится в основном в цитоплазме, где он является важным компонентом процесса трансляции (верхний левый квадрат). После теплового шока (левый нижний квадрант), часть eEF1A1 обнаруживается в непосредственной близости от гена HSP70, где он способствует связыванию HSF1 с HSP70, тем самым активируя транскрипцию.eEF1A1 взаимодействует с RNAP II РНКП II и связывает 3'UTR мРНК HSP70 для стабилизации транскрипта и экспорта его в цитоплазму. Благодаря синхронизации основных этапов экспрессии генов HSP70, eEF1A1 стабилизирует процесс HSR, делая его надежным и скоординированным. В клетках с нокдауном по фактору eEF1A уровень HSP70 остается низким, даже после воздействия стресса (правый нижий сектор) .

5.2.2. Особенности строения промотора hsp70

это основной тепло-индуцируемый внутриклеточный шаперон HSP70 Drosophila melanogaster, который обеспечивает не только толерантность к стрессу (Feder и Krebs 1998), но и также принимает участие в регулировании клеточного роста и смерти клетки (Zatsepina et al. 2001; Gabai и Sherman 2002). Повышенный уровень HSP70, как правило, выгоден для термотолерантности, но вреден для роста и развития (Krebs и Feder 1997, 1998; Zatsepina et al., 2001). Количество генов, кодирующих HSP70, варьирует .

Например, у Drosophila melanogaster, не менее пяти генов кодируют HSP70. У человека существует не менее 11 генов семейства HSP70, которые кодируют белки с молекулярной массой от 66 до 78 кДа. (Bettencourt и Feder 2002). Ввиду строгой регуляции транскрипции генов hsp70, удаленные участники промотора контролируют изменения уровня экспрессии hsp70 .

Промотор hsp70 в эволюции животного мира достаточно слабо изменяется. Так, например, было показано при сравнительном анализе сходства промоторов гена hspA1A человека и hspA1A мыши, что идентичность последовательности этими промоторами составила 70%. (Wu et al., 1986; Greene et al., 1987; Williams and Morimoto 1990; Bevilacqua et al., 1997; Bevilacqua et al., 2000) .

В работе Reinaв определены 11 элементов необходимых для транскрипции: два элемента теплового шока (HSEs; Hsf1/2),), три GC элемента (Sp1), три AP2 элемента (AP2), два CCAAT элемента (CTF/CBF/CREB связывающий белок (CBP)), и один TATA элемент (TFIID), которые связываются с факторами транскрипции. (Reina 2012) .

Обнаружены три-четыре различия между регуляцией человеческого и мышиного промоторов: (1) мышиный не имеет GC элемента в области 245, (2) обнаружены замены элемента AP2 у мышей в положении -20 на GC элемент и (3) замены CCAAT элемента в области 152. Вероятно, подобные замены незначительно влияют на регуляцию hsp70. При этом было отмечено, что большое количество элементов регулирующих экспрессию hsp70 позволяет промотору данного гена реагировать на различные изменения в окружающей среде, а также на состояние стресса в организме .

Интерес к изучению подобной тонкой регуляции активации промотора не снижается до сих пор. В работах Ray с соавторами исследован промотор в гене человека hspA1A и его регуляторная зона. Было изучено 296 пар азотистых оснований от 259 до +37 относительно сайта инициации транскрипции (Ray et al., 2004); в данной зоне расположены основные и инициируемые элементы регуляции НSP70. Было показано, что помимо элементов HSE, которые необходимы для активации в условиях вызванных стрессом, на данном участке обнаруживается присутствие девяти элементов, таких как три GC участка, два CCAAT, три AP2 элемента и TATA участка. (Wu et al., 1986;

Greene et al., 1987; Williams et al., 1989; Williams and Morimoto 1990; Bevilacqua et al., 1997; Christians et al., 1997). Промотор мыши hspa1a наиболее близок к человеческому hsp70 промотору, но имеет незначительные отличия и состоит из элементов HSEs, четырех GC, одного CCAAT участков, одного AP2 элемента, одного AP1 элемента, и TATA участка. (Bevilacqua et al., 1997; Christians et al., 1997; Bevilacqua et al., 2000) .

Кроме того, было обнаружено, что к HSE-последовательности примыкает белок, содержащий в своей структуре гидрофобный лейцин- изолейциновый повтор (nLIR), ответственный за олигомеризацию HSF ( Schaif et al., 1990, Peteranderl et al., 1992 ). В С-терминальной области расположен третий домен, который выполняет трансактивационную функцию HSF и in vivo в отсутствие стресса подвержен негативной регуляции (Peteranderl et al., 1992, Chen et al., 1993, Green et al., 1995, Shi et al., 1995, Wisniewski et al., 1996 ). К последнему домену с N-конца примыкает еще один лейцинизолейциновый повтор (cLIR) (Rabindran et al., 1993, Zuo et al., 1994). Его присутствие или целостность необязательны для трансактивации (Wisniewski et al., 1996) .

Интенсивная транскрипция генов hsp70 активируется связыванием фактора теплового шока (HSF) с элементами регуляции теплового шока в промоторе каждого гена hsp70. В то время как HSEs 1 и 2 достаточно для транскрипции нескольких генов HSP70, для полной транскрипции требуется все четыре HSEs (Xiao и Lis 1988; Lee et al., 1994; Shopland et al., 1995). Важным считается так же расстояние между линейно расположенными HSEs факторами. Существование участков из 1-5 и 11-14 нуклеотидов между HSEs 1 и 2 снижает активность промотора на 90%, в то время как участки из 6-10 и 16-18 нуклеотидов в значительной степени восстанавливают активность промотора ( Amin et al., 1994 ) .

В ряде работ показано, что HSF млекопитающих способен взаимодействовать с промотором гена HSP70 Dr.melanogaster и активировать его (Павлова Г.В. и др. 2005) .

Встает вопрос, возможно ли использование этого промотора для активации терапевтических генов. Преимущество данного промотора в том, что он может активироваться при повышении температуры или при воспалительных процессах. Почему интересен именно промотор гена hsp70 Dr.melanogaster? Потому что, промотор млекопитающих активизируется при слишком высоких температурах и не может быть использован. В ряде работ утверждается, что исследуемый промотор в клетках млекопитающих активизируется при 42°С, что крайне травматично для клеток, и снижает возможности использования промотора в практике (Glazenburg К et al. l992, Roigas J. Et al .

1997). Тогда как в работах Павловой Г.В. показано, что промотор гена hsp70 Dr.melanogaster, попадая в клетки млекопитающих, не активизируется при 37°С, как это могло ожидаться (температура активации в клетках дрозофилы), но и не подчиняется температурному режиму активации млекопитающих 42°С. Показано, что его активация наблюдалась с 40°С. Тогда встает вопрос о возможности регулируемости данной активации. Ведь если появится возможность снизить активацию промотора до 39 °С, то это будет уже приемлемая температура для клеток млекопитающих, не приводящая к термальным повреждениям эти клетки. Обнаруженное в работах изменение температурного воздействия на активацию промотора гена hsp70 Dr.melanogaster может быть связан с факторами регулирующими процесс активации промотора (Павлова Г.В. и др. 2005). Например, помимо триммера HSF в регуляции изучаемого промотора также участвует белок CHBF (constitutive HSE-binding factor). Данный белок в отсутствие воздействия теплового шока конститутивно связан с регуляторной областью промотора hsp70, причем было обнаружено, что даже если спровоцировать тримеризацию HSF, активация HSP70 все равно не произойдет. Белок CHBF освободит место для триммера только после воздействия теплового шока (или другого стрессового воздействия) (Jacoby et al., 1994). В условиях теплового шока CHBF вытесняется HSF. Было обнаружено, что нормальных клетках млекопитающих мягкий тепловой шок (41°С), хотя и вызывает активацию HSF, но не приводит к индукции HSP70, и CHBF остается связанным с промотором hsp70. При воздействии более высоких температур CHBF покидает промотор и замещается HSF. Вероятно, на этом и может быть основано изменение температурного интервала для промотора дрозофилы в трансфицированных клетках hsp70 млекопитающих. CHBF млекопитающих имеет меньшую гомологию с участком связывания и соответственно освобождает место для триммера при более низкой температуре, чем температура теплового шока млекопитающих, сдвигая, таким образом, температурный интервал активности может снижаться. Таким обазом, появляется необходимость поиска изменений в регуляции промотора, для достижения снижения температуры активации. В данной работе мы попытались изучить влияние увеличения HSE областей на чувствительность промотора .

Глава 2 . МАТЕРИАЛЫ И МЕТОДЫ

2.1. Объекты

1) Escherichia coli, штамм DH5 .

2) Линия клеток клеток НЕК293, полученная из почки эмбриона человека НЕК293 .

3) Линия клеток РС 12 - клетки феохромоцитомы крысы .

4) Спинальные ганглии эмбриона крысы Е15 .

2.1.1. Белки, ферменты и реактивы В работе использовались реактивы, производимые фирмами Sigma (USA), Amersham Biosciences (Sweden), Gibko BRL (USA), BioRad (USA) и ферменты производства фирм Thermo Scientific (Litvenia), Promega (USA). Праймеры (T3, M13 и другие) были заказаны в фирме Евроген (Москва) и Литех (Москва). Сиквенирование проводилось в ЦКП “Геном” ИМБ РАН с помощью BigDye terminator chemistry .

Последовательность гена нейротрофического фактора человека GDNF согласно базе данных UniProtKB Р39905 первой изоформе Р39905-1 была искусственно синтезирована фирмой Евроген (Москва). Вектора EGFP-N1 (GenBank Accession #U55762) и CaSpeR (GenBank Accession #U60735) были куплены у фирмы Clontech (USA), вектор pET-15b Vector (Номер каталога: 66961) приобретен у фирмы Millipore (Germany) .

2.2. Общие методы работы с бактериями Escherichia coli .

2.2.1.Получение компетентных клеток Клетки из музея штамма E.coli DH5 истощающим штрихом высевались на чашку Петри со средой LB-агар, инкубировались 14 часов при 37°C в воздушном термостате .

Отдельную колонию инокулировали в 5 мл среды SOB (Tryptone 2%, yeast extract 0,5%, NaCl 0,5%, 2,5 мМ KCl, 10 мМ MgSO4, 10 мМ MgCl2) без антибиотика для получения ночной культуры и растили при 20°C около суток с хорошей аэрацией в термостатированной качалке при интенсивности перемешивания 180 об/минуту. Далее, 250 мкл этой культуры высевали в колбу объемом 2 л со средой SOB (250мл) и растили при 20°C и интенсивности перемешивания 180 об/минуту до оптической плотности суспензии клеток (OD) 0,6 – 1,0 при =600 нм. Затем клетки охлаждали во льду около 10 минут и переносили в охлажденный центрифужный стакан на 250 мл и откручивали на центрифуге при 1200g 10 мин при 0-4°C. Осадок клеток ресуспендировали в 80 мл охлажденного во льду буфера ТБ (10 mM PIPES или MOPS, 55mM MnCl2, 15mM CaCl2, 250mM KCl), инкубировали во льду 10 мин, осаждали центрифугированием при 770g 10 минут при 0-4°C. После этого осадок клеток ресуспендировали в 20 мл буфера ТБ и, медленно перемешивая. Затем инкубировали в течение 10 мин на льду, разносили по 100 мкл суспензии клеток в охлажденные пробирки, замораживали в жидком азоте и хранили при -70°C .

2.2.2.Трансформация компетентных клеток плазмидами

Порции компетентных клеток (200 мкл) размораживали при 0С в течение 15 мин. В компетентные клетки, добавляли 5-50 нг плазмидной ДНК и инкубировали 0С в течение 15-45 мин. Нагревали 2 мин при 42С. Затем охлаждали 15 мин при 0С. В пробирки добавляли 0,8 мл среды LB (1% бактотриптон, 0,5% дрожжевой экстракт, 1% NaCl) и инкубировали на шейкере 1 ч при 37С. Клетки рассевали на чашки с селективной средой содержащей 15-20 мл среды LB-агар (1% бактотриптон, 0,5% дрожжевой экстракт, 1% NaCl, 1,5% агар), инкубировался около 14-16 часов. К среде LB-агар добавляли селективный антибиотик (50 мкг/мл) ампициллина или канамицина (в зависимости от наличия в плазмиде гена устойчивости к тому или иному антибиотику) и инкубировали в термостате при 37°С ночь. Выросшие одиночные колонии переносили в 2 мл среды LB (50 мкг/мл ампициллина или канамицина) и растили 12-14 ч при 37°С на шейкере .

2.3 Методы работы с ДНК 2.3.1. Выделение плазмидной ДНК из Е. сoli в малом объеме (Miniprep) 1,5 мл ночной культуры осаждали 5 мин при 13000 об/мин в центрифуге фирмы «Eppendorf». Осадок ресуспендировали в 100 мкл ТELT (50 мМ Tris-HCl; 62,4мМ EDTA;

0,4% Triton-X100; 2,5 мМ LiCl) с добавлением 10 мкл лизоцима (Стоковый раствор с концентрацией 10 мг/мл хранили порциями при -20С. Повторному замораживанию раствор не подвергался) и инкубировали пробирки при 95°С 1 мин, а затем 5 мин во льду .

После этого пробирки с лизатом клеток центрифугировали 15 мин при 13000 об/мин .

удаляли денатурированные белки. К супернатанту добавляли 1/10 объема 3М ацетата натрия, рН 4,8, и равный объем изопропанола. Пробирки выдерживали 20 мин при -20°С, центрифугировали 20 мин при 13000 об/мин, супернатант удаляли, осадок промывали 75% этиловым спиртом и после высушивания растворяли в 20 мкл деионизированной воды. Далее к образцу добавляли 10мМ раствор РНКазы и инкубировали 60 мин при 37°С .

К образцу добавляли 280 мкл деионизированной воды и равный объем смеси фенол/хлороформ (1:1), тщательно встряхивали и центрифугировали 10 мин, 13000 об/мин. Верхнюю фазу отбирали, переносили в пробирку, добавляли равный объем хлороформа, центрифугировали 10 мин, 13000 об/мин. Верхнюю фазу отбирали, добавляли 1/10 объема 3М ацетата натрия, рН 4,8, и равный объем изопропанола .

Пробирки выдерживали 20 мин при -20°С, центрифугировали 20 мин при 13000 об/мин, супернатант удаляли, осадок промывали 75% этиловым спиртом и после высушивания растворяли в 20 мкл деионизированной воды .

2.3.2. Выделение плазмидной ДНК в большом объеме (Maxiprep)

Одну колонию бактерий инокулировали в 50 мл среды LB с добавлением антибиотика (канамицин 50 мкг/мл или ампициллин 100 мкг/мл), выращивали при 37°C и при интенсивном перемешивании в течение 12-15 часов. Полученную ночную культуру осаждали центрифугированием (10 мин, 4500 об/минуту). Осадок клеток растворяли в 3,5 мл S1-буфера (Tris-HCl 0,05 М, EDTA 0,01 М), инкубировали в течение 2-5 мин при комнатной температуре. Затем добавляли 3,5 мл S2-буфера (NaOH 0,2 M, SDS 1%), инкубировали в течение 3-7 мин при -20°C и плавно перемешивали. Далее добавляли 3,5 мл холодного ацетата калия (3M, pH 4,8-5,2), тщательно перемешивали и охлаждали в течение 10-15 мин при -20°C. Затем осаждали центрифугированием при 4500 об/минуту в течение 15 мин. Отбирали супернатант аккуратно без примесей и в него добавляли 6,5-7,5 мл изопропилового спирта, перемешивали, выдерживали в течение 10-15 мин при -20°C .

Полученный раствор откручивали при 4500 об/минуту в течение 15 мин, выливали супернатант и осадок просушивали в термостате при 50°C и далее растворяли в 1 мл AcNH4 (2 M). Затем раствор охлаждали в течение 10-15 мин при -20°C, откручивали на цетрифуге в течение 5-10 мин при 13000 об/минуту, переносили супернатант в чистую пробирку. Добавляли 0,7 объема изопропилового спирта, держали в течение 10-15 мин на холоде при -20°C. Центрифугировали при 13000 об/минуту в течение 10 мин и осадок промывали 150 мкл 70% этанола и осадок просушивали в термостате при 50°C и растворяли в 200 мкл деионизованной воды .

2.3.3.Электрофорез в агарозном геле

Для разделения фрагментов ДНК и определения количества выделенной ДНК использовали, в зависимости от размера фрагментов, 0,7-1,5% агарозный гель с добавлением бромистого этидия (0.1 мкг/мл). Электрофорез проводили в однократном буфере ТАЕ (Tris base 0,04 М, EDTA 1 мМ, CH3COOH 0,01 М, pH 8.3), при напряжении 1,5-2 см2 геля. Для визуализации фрагментов ДНК к образцам добавляли 10x буфер для нанесения (бромфеноловый синий 0.25%, ксиленцианол 0.25%, ЭДТА (pH 8,0) 0,1 М, глицерин 50%) и наносили в лунки агарозного геля для электрофореза. Свечение ДНК и РНК оценивали на приборе трансиллюминаторе в ультрафиолетовом свете .

2.4. Методы генетической инженерии 3.4.1.Полимеразная цепная реакция (ПЦР) .

Состав реакционной смеси: 1 буфера для Taq – полимеразы c 2 мМ MgCl2 (Fermentas, # K0181), 0,2 мМ каждого dNTP (Fermentas, # R0072), 10 µМ каждого праймера, 0,8 ед Taq – полимеразы (Fermentas, # EP0401). Перечень праймеров использованных в работе представлено в таблице 1. Комбинация праймеров составлялась в зависимости от этапа эксперимента. Амплификацию проводили в амплификаторе MJ Mini™ Personal Thermal Cycler (Bio-Rad, # PTC1148). Результаты ПЦР проверяли методом электрофореза в 1% агарозном геле в трис – ацетатном буфере ТАЕ (Tris base 0,04 М, EDTA 1 мМ, CH3COOH 0,01 М, pH 8.3) .

Таблица 1. Праймеры, используемые в работе .

–  –  –

GDNFpr(F) CCACC ATGTCACCAGATAAACAA

GDNF BamH1 (R) TGGATCCCAGATACATCCACACCTTTTAGCGG

CTCGAGCCACCATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCT

GDNFPre(F) GCTCCACACCGCGTCCGCCTCACCAGATAAACAAATGGCAGTGCTTCC

TAGAA

GDNFPro (F) CTCGAGCCACCАTG TTCCCGCTGCCCG CCGGTAAGAG

Т3 (F) ATTAACCCTCACTAAAGGGA

GAPDH(R) CCCCTGGCCAAGGTCATCCATGACAACTT

GAPDH(F) GGCCATGAGGTCCACCACCCTGTTGCTGT

GDNF(F) GGAATCGGCAGGCTCAGCTG

GDNF(R) AATGCTTTCTTAGAATATGGT

GFP (R) CTTGTACAGCTCGTCCATGC

GFP (F) GTGAGCAAGGGCGAGGAGCT

neo (F) ATGATTGAACAAGATGGATT neo ( R ) TCAGAAGAACTCGTCAAGAA

Сasp1F GATCAAGCTTGTTCAATGATATCCAGTGC

Casp5F CCCAAAGCTTGGATTTTTCACACTTTCCCC

CaspR TAACGAATTCCCAATTCCCTATTCAG

GDNFmNdeI CATATGTCACCAGATAAACAA

GDNFSTPBamHI TGGATCCTCAGATACATCCACACCTTTTAGCG

NdePrePet15 CATATGAAGTTATGGGATGTCG NdeProPet15 CATCTGTTCCCGCTGCCCGCCG

TATTTAGGTGACACTATAG

SP6

T7 TAATACGACTCACTATAGGG

CGCCAGGGTTTTCCCAGTCACGAC

M13(F)

TCACACAGGAAACAGCTATGAC

M13 ( R )

CMV- N1 GGATAACTGCAGTTACTGCCATTT

GDNF(m) EcoRV GATATCCCACCATGTCACCAGATAAACAA

2.4.2.Рестрикция плазмидной ДНК

Рестрикцию плазмидной ДНК проводили в пробирках объемом 1,5 мл производства фирмы «Eppendorf». Реакционная смесь общим объемом 20 мкл включала в себя: 0,5 – 5 мкг плазмидной ДНК, рестриктазу производства фирм Promega или Fermentas из расчета 1 единица фермента на 1мкг ДНК, соответствующий 1x буферный раствор производства тех же фирм. Рестрикцию проводили 1 ч при 37С. Полученные продукты анализировали при помощи электрофореза в агарозном геле от 0,8 до 1,5% .

2.4.3. Выделение фрагментов ДНК из геля

Выделение фрагментов ДНК из геля проводили с помощью набора реагентов QIAquick® Gel Extraction Kit (QIAGEN, #28706). После проведения электрофореза в 1% агарозном геле полосу ДНК соответствующей подвижности вырезали и помещали пробирку, после чего его взвешивали. На 300 мг геля с фрагментом ДНК добавляли 800 мкл QG Buffer, растворяли гель в буфере с помощью интенсивного встряхивания на вортексе. Добавляли 200 мкл изопропанола, пипетировали. Раствор переносили на колонку. Центрифугировали 2 мин. при 3000 об/мин. Жидкость из коллекционной пробирки сливали, добавляли еще 400 мкл QG Buffer и цетрифугировали 2 мин. при 3000об/мин. Жидкость из коллекционной пробирки сливали, в колонку приливали 500 мкл Wash Buffer, центрифугировали в течение 30 сек. при 13000 об/мин. Колонку переносили в чистую пробирку объемом 1,5 мл, на мембрану колонки наносили 25 мкл EB Buffer, инкубировали 1 мин. при комнатной температуре. Центрифугировали 3 мин., происходила элюция ДНК. Концентрацию ДНК в полученном растворе определяли при помощи электрофореза в агарозном геле от 0,8 до 1,5% .

2.4.4. Лигирование К 100-200 нг вектора добавляли вставку в молярном соотношении от 1:1 до 1:8, 1 мкл 10х буфера для T4 ДНК-лигазы, 1 мкл Т4 ДНК-лигазы и доводили объем до 10 мкл бидистиллированной водой. Смесь инкубировали ночь при +40С, далее ею трансформировали компетентные клетки .

2.4.5. Анализ ДНК-последовательности Секвенирование ДНК проводили с помощью набора реактивов ABI PRISM® v. 3.1 с последующим анализом продуктов реакции на BigDye™ Terminator автоматическом секвенаторе ДНК ABI PRISM 3100-Avant (Межинститутский Центр коллективного пользования «ГЕНОМ» ИМБ РАН (http://www.genome-centre.narod.ru/), организованный при поддержке РФФИ (грант №13-04-40200) .

2.4.6. Схема клонирования продукта амплификации в pGEM® - T Easyвектор .

Продукт амплификации выделяли из геля, после чего проводили лигирование с продуктом, фирмы Promega pGEM® - T Easy Vector с прилагаемыми реактивами (Promega, # 20170-310). Проба смеси для лигирования объемом 10 мкл, включала в себя: лигазный буфер (2х– Rapid Ligation Buffer), pGEM® - T Easy вектор (pGEM® - T Easy Vector 50нг), продукт амплификации (25 нг), T4 лигазу (T4 DNA ligase 3 weiss units|µl). Лигирование осуществлялось ночь при 12С. Для трансформации вектора pGEM® - T Easy в лигазную смесь были добавлены предварительно размороженные компетентные клетки JM 109 Competent Cells (Promega, # 2004) и оставлены на час во льду. Далее клетки подвергались тепловому шоку при 42С 1,5 мин., после чего снова выдерживались во льду15 мин. После этого добавляли 800 мкл буфера SOC. (Tryptone 2%, yeast extract 0,5%, NaCl 0,5%, 2,5 мМ KCl, 10 мМ MgSO4, 10 мМ MgCl2, 10 мM MgSO4, 10 мM С6Н12О6) инкубирование проводилось при 37С 1 час при постоянном покачивании. Приготовили селективный LBагар (1% бактотриптон, 0,5% дрожжевой экстракт, 1% NaCl, с добавлением агара. Для проведения бело-голубой селекции в селективный LB агар был растерт 0,5М X-Gal (Promega, # V3941) и 0,1M IPTG (Promega, # V3955) и после этого посеяны клетки с остатками лигазной смеси. Инкубацию проводили ночь при 37С. Для дальнейшей работы были отбраны лишь несколько колоний белого цвета, имеющих вставку гена цитохром b (голубые колонии вставки не имели). По одной колонии растили в пробирках на качалке ночь при 37С в селективной среде LB. Затем наращивали ночную культуру в селективной среде с добавлением 0,1мг ампициллина. Наличие вставки проверяли рестрикцией по рестриктазе Eco RI (Fermentas, ER0271) с последующим электрофорезом в 1% агарозном геле в ТАЕ буфере .

2.4.7. Очистка плазмид для введения в культуру клетокмлекопитающих .

Очистку плазмид проводили при помощи Gel Band Purification Kit. Объем раствора, содержащего 15-25 мкг плазмидной ДНК, доводили деионизованной водой до 100 мкл, добавляли 500 мкл Capture Buffer и переносили раствор на колонку, помещенную в коллекционную пробирку. Выдерживали 1 минуту при комнатной температуре, центрифугировали 30 с, 13 тыс. об/мин. Жидкость из коллекционной пробирки сливали, в колонку приливали 500 мкл Wash Buffer, центрифугировали 30 с, 13 тыс. об/мин. Колонку переносили в чистую пробирку объемом 1,5 мл, на мембрану колонки аккуратно наносили 50 мкл бидистиллированной воды, инкубировали 1 мин при комнатной температуре .

Центрифугировали 1 мин., происходила элюция ДНК. Концентрацию ДНК в полученном растворе определяли при помощи электрофореза в агарозном геле от 0,8 до 1,5% .

2.5. Работа с культурой клеток НЕК293 2.5.1 Ведение культуры клеток НЕК293 Для анализа экспрессии нейротрофического фактора GDNF использовалась линия клеток, полученная из почки эмбриона человека НЕК293. Для культивирования НЕК 293 применялась среда DMEM (ПанЭко, Россия), при добавлении 10% фетальной сыворотки крови (Perbio HyClone, США), L-глутамина (ПанЭко, Россия) и 4% гентамицина (ПанЭко, Россия). Культура клеток инкубировалась при 370С в СО2 инкубаторе. Клетки росли на площади 25 см2, во флаконах («Costar») .

2.5.2. Введение плазмиды в клетки линии НЕК293 методомтранфекции

В стерильной пластиковой пробирке объемом 1,5 мл фирмы «Eppendorf»

смешивали 3 мкг плазмидной ДНК и 187,1 мкл 150 мМ NaCl и тщательно перемешивали .

Добавляли 9,87 мкл ExGen 500 Transfection Reagent и перемешивали, инкубировали при комнатной температуре 10 мин. Затем смесь добавляли к клеткам линии НЕК293, растущих на 35 мм чашке (плотность – 50-70%) в 2 мл среды. Инкубировали в термостате при 37С, 5% СО2 .

2.5.3. Анализ промотора hsp70 Drosophila melanogaster с регуляторнойпоследовательностью

Трансгенные клеточные линии HEK293/B7 и HEK293/F7, содержали промотор hsp70 Drosophila melanogaster и маркерный ген зеленого флуоресцентного белка GFP под его контролем. Клетки линий HEK293/B7 и HEK293/F7 были подвержены воздействию температур от 370С до 430С. Для этого культура клеток была рассеяна на культуральные чашки фирмы Costar, диаметром 35мм. По достижению конфлюенции клеток около 60от общей площади культивирования клетки были подвержены прогреванию при различной температуре (от 38 до 42С0). После температурной обработки данные культуры были культивированы при обычных условиях. Физиологическое состояние клеток после температурной обработки было оценено через 24 и 48 часов. Экспрессию маркерного белка GFP наблюдали с помощью флуоресцентного микроскопа Olympus. Параллельно с визуализацией экспрессии зеленого белка, после 24 часовой температурной обработки в каждом интервале температур 1/3 клеток были дважды обработаны раствором PBS и далее фиксированы 4% раствором формальдегида. Аналогично было проделано с клетками после 48 часов. Фиксированные клетки использовались для измерения интенсивности свечения при помощи метода проточной цитофлуориметрии на приборе FACScan (Becton Dickinson, США). Оставшаяся треть клеток была прокультивирована в обычных условиях и по истечению 4 суток была вновь подвержена воздействию температуры .

Исследование полученных конструкций с GDNF .

На трансгенные клеточные линии B7/GDNF/GFP и F7/GDNF/GFP воздействовали температурой 400С и 420С, данные температуры выбраны после исследования экспериментальных векторов B7 и F7. Экспрессию маркерного белка GFP анализировали с использованием флуоресцентного микроскопа Olympus. Одновременно с визуализацией экспрессии зеленого белка, после 24 часов температурной обработке в каждом интервале температур 1/3 клеток были дважды обработаны раствором PBS и далее фиксированы 4% раствором параформальдегида. Подобное было проделано с клетками после 48 часов .

Фиксированные клетки использовались для измерения интенсивности свечения при помощи метода проточной цитофлуориметрии на приборе FACScan (Becton Dickinson, США) .

2.5.4. Получение трансгенных клеточных культур .

По мере нарастания культуры клеток НЕК293 до концентрации 1.5 105клеток мл1, клетки подвергались трансфекции полученными конструкциями: pre-proGDNF/pEGFP-N1, mGDNF/pEGFP-N1, pre-GDNF/pEGFP-N1, prо- GDNF/pEGFP-N1, B7, F7, B7/GDNF/ pEGFP-N1 и F7/GDNF/ pEGFP-N1. Трансфекция осуществлялась с помощью реагента ExGene 500(Fermentas, R0511), согласно протоколу. Селекция клонов, несущих встроенные конструкции, проводилась с помощью реагента гентамицина (G418, Invitrogen # 15750045), в течение десяти дней. После селекции с использованием антибиотика клоны устойчивые к G418 были использованы для выделения РНК для последующего синтеза кДНК. Метод обратной транскрипции применялся для подтверждения встраивания конструкций в геном клеток. В результате были получены линии трансгенных культур: HEK293/pre-pro-GDNF/GFP, HEK293/mGDNF/GFP, HEK293/pre-GDNF/GFP, HEK293/prо-GDNF/GFP, HEK293/B7, HEK293/F7, HEK293/B7/GDNF/GFP и HEK293/F7/ GDNF/GFP .

2.6. Определение уровня экспрессии репортерных генов 2.6.1. Выделение тотальной РНК из культуры клеток НЕК 293 .

Клеточная культура была промыта раствором Версена и снята с подложки культурального пластика раствором трипсина. Далее смесь клеток с трипсином центрифугировали, осадок промывали раствором PBS, затем все процедуры проводили на холоду. Клетки лизировали TRI REAGENTTM (Sigma, # Т 9424) при пипетировании .

Оставляли на 5 мин при комнатной температуре, добавляли 0,2 мл хлороформа на 1 мл TRI REAGENTTM, энергично встряхивали 15 сек., а затем снова оставляли на 2 – 15 мин при комнатной температуре. Центрифугированием отделяли осадок и водную фазу. После переноса водной фазы в новую пробирку, добавили 0,5 мл изопропанола на 1 мл TRI REAGENTTM. Все смешали и оставили на 5 – 10 мин при комнатной температуре, центрифугированием разделяли осадок и надосадочную жидкость. После этого промывали осадок РНК 75% C2H5OH, а затем высушивали осадок на воздухе. Осадок РНК растворяли в дважды дистиллированной воде, свободной от РНКазы .

2.6.2. Получение кДНК к GDNF (Обратная транскрипция) .

Для данной работы пользовались набором реагентов First Strand cDNA Synthesis Kit (Fermentas, # K1612). 1мкг РНК быстро и аккуратно смешивали с 0,5 мкг олиго (dT)18 праймером, после чего инкубировали в амплификаторе 5 мин. при 70 C, затем быстро переносили в лед. Добавляли 5 реакционный буфер (4мкл), 20 ед Ribo LockTM ингибитора рибонуклеаз, 10 мМ смеси dNTP (2 мкл) и инкубировали 5 мин. при 37C. Затем добавляли 40 ед M-MuLV обратной транскриптазы. Инкубировали в течение часа при 37C. Реакцию останавливали нагреванием при 70C 10 мин. Полученный продукт кДНК выделяли из 1 % агарозного геля с помощью колонок фирмы QIAGEN по методике, описанной выше, хранили при - 20C .

2.6.3. Обратная транскрипция .

–  –  –

GDNF( F) 5’-ggaatcggcaggctgcagctg- 3’) и GFP ( R) 5’-aataaagcttgcatggcggtaatacg- 3’; neo ( R ) 5’-tcagaagaactcgtcaagaa - 3’ и neo (F) 5’-atgattgaacaagatggatt-3’.

Программа для ПЦР:

940С-2 мин, 930С – 10 сек, 580С – 20сек, 720С – 30 сек, 720С – 5 мин. Количество циклов было равно 30 .

2.6.4. Выделение белка из клеток для Вестерн-блот гибридизации .

Для приготовления лизатов клеток для Вестрн-блоттинга культуры клеток за 24 часа до лизирования были переведены на питательную среду в отсутствии фетальной сыворотки крови. После 24 часов культивирования была удалена культуральная среда, клетки были промыты раствором Версена (ПанЭко, Россия) и далее сняты с подложки с использованием раствора Трипсина (ПанЭко, Россия). Клетки были диссоциированы и перенесены в пробирку. Далее центрифугировали при 3000 rpm 5 минут и удаляли супернатант.

Клетки лизировали раствором буфера для нанесения образцов (по Лэммли:

62 мМ трис-HCl буфер рН 6,8, 3% SDS, 25% мочевина, 15% глицерин, 5% меркаптоэтанол, 0,01% бромфеноловый синий, 10% сахароза) .

2.6.5. Выделение белка из кондиционированной среды культурклеток .

Первоначальным этапом является процесс отмывки клеточной культуры от присутствия сыворотки крови в среде. Для этого нами была разработана схема отмывки клеточной культуры. За 24 часа до сбора кондиционной среды мы промывали культуру клеток по схеме: 1) смена полноценной среды на бессывороточную и инкубация 4 часа. 2) замена данного раствора на раствор Версена и быстрое споласкивание 3) добавление раствора ДМЕМ с глутамином и на шейкере промывание трижды по10 минут 4) добавление к клеткам свежей среды ДМЕМ с глутамином и инкубирование 18-20 часов в СО2 инкубаторе при 37С0. Через 20 часов собирали кондиционированную культуру с клеточных линий и выделяли белок с использованием 7% трихлоруксусной кислоты в присутствии ацетона. Далее высаженные белки были растворены в буфере по Лэммли .

2.6.6. Электрофорез белков в полиакриламидном геле .

Для подготовки образцов клетки линии снимали с флаконов. Добавляли небольшое количество среды, в которой культивировались клетки, и переносили в пробирки для центрифугирования. Центрифугировали 5 мин., 3000 об/мин. Клетки отмывали в растворе PBS 3 раза, центрифугируя по 5 мин. при 3000 об/мин. Осадок ресуспендировали в 60 мкл буфера для нанесения образцов, затем образцы помещали на водяную баню при 100С на 5 мин. После этого центрифугировали при 14000 об/мин 20 мин., надосадочные жидкости переносили в новые пробирки. Электрофорез проводили в вертикальных пластинах полиакриламидного геля. Гель состоял из разделяющего 10% ПААГ: 0,375М трис-HCl,

pH 8,8, 10% акриламид/бис, 0,1% глицин, 0,1 % SDS и ПСА и концентрирующего гелей:

0,125 М трис HCl буфер рН 6,8; 4% акриламид: бисакриламид; 0,1% глицерин; 0,1% SDS;

0,05% ТЕМЕD; 0,025% ПСА. Размер геля 70х80х0,75 мм. Электрофорез протекал в условиях 100В 90 мин в электродном буфере (0,25 М трис-HCl буфер рН 8,3; 1,92 М глицин; 0,1% SDS). На дорожку наносили по 10-15 мкл образца, концентрацию которого заранее выравнивали по актину. В качестве маркера использовали PageRuler™ Plus Prestained Protein Ladder (Fermentas, # SM1811) .

2.6.7. Вестерн-блот гибридизация .

После проведения электрофореза образцов в ПААГ осуществляли перенос белков на трансблоттере с геля на мембрану. Для этого в кассету для переноса помещали несколько листов влажной бумаги Whatman 3MM, смоченных буфером для переноса белков с геля на мембрану (0,025М трис-НСl pH 8,3; 0,129М глицин; 20% метанол), влажную нитроцеллюлозную мембрану HybondTM ECLTM (Amersham, # FN 0311-1), гель, и несколько листов бумаги Whatman 3MM, так же смоченных буфером для переноса .

Кассету закрывали, ставили между электродами. Перенос осуществляли в течение часа, выставив ограничение в напряжении 100В в буфере для переноса. Процесс протекал с использованием холодильника для охлаждения. Далее мембрану помещали в 5% раствор обезжиренного молока на TBS-Т (20 мМ трис-HCl, pH 7,5; 150 мМ NaCl; 0,1% Tween-20) и инкубировали на шейкере 90 мин при комнатной температуре. Отмывали мембрану раствором TBS-Т три раза по 5 мин. Далее инкубировали мембрану с добавленными первичными антителами. Процесс осуществлялся с использованием шейкера при температуре 4С 12 часов. Отмывку от первичных антител проводили 3 раза раствором по 5 мин. Затем мембрану обрабатывали вторичными антителами, TBS-Т коньюгированными с пероксидазой. GDNF был детектирован с помощью антител антиGDNF (D20, Santa Cruz), поскольку у нас в работе использовался химерный GDNF, то его детекция так же осуществлялась с помощью анти-GFP (MAB2510, Chemicon). При воздействии первичными мышиными антителами пользовались вторичными антимышинными (Имтек, P-GAM # 60718) в титре 1:5000 на 1% обезжиренном молоке на TBST. При воздействии первичными кроличьими антителами использовали вторичные антикроличьи антитела (Имтек, P-GAR # 60226) в титре 1:2000 на 2% обезжиренном молоке на TBS-T. Обработка вторичными антителами протекала на шейкере при комнатной температуре в течении 1 часа. Затем мембрану отмывали от вторичных антител TBS-Т три раза по 5 мин. Проявляли при помощи Lumigen™ PS- 3 detection reagents (GE Health care L™, # RPN21321V1 и RPN21321V1), согласно предложенной инструкции. Проявку проводили с использованием детектирующего раствора данного состава: метол – 1 г;

гидрохинон – 5 г; сульфит натрия – 26 г; гидрокарбонат натрия – 20 г бромид калия – 1 г;

дистиллированная вода – до 1 л. Далее осуществляли фиксацию раствором следующего состава: тиосульфат натрия – 300 г; сульфит натрия – 20 г; уксусная кислота – 15 мл;

дистиллированная вода – до 1 л .

2.7. Модели для анализа нейропротекторной способности изоформ GDNF 2.7.1. Получение кондиционированных сред с трансгенных клеточных линий .

Трансгенные культуры рассевались на площади 25см2, по достижению конфлюентности около 60% от общей площади питательная среды (DMEM/F12; 2 мМ Lглутамин; 10% фетальная сыворотка коровы; гентамицин – 50 мкг/мл) была заменена на новую, далее через 24 часа культивирования при 37С0 среда с клеток была собрана для последующего анализа. Для селекции трансфицированных клеток к среде добавляли G418 до конечной концентрации 400 мкг/мл .

Кондиционированная среда с трансгенных клеточных линий перед сбором была предварительно профильтрована через 0,22нм целлюлозно-ацетатный фильтр с низким связыванием белка («Corning») фильтр, что необходимо для избавления от остатков клеточных агломератов .

2.7.2. Получение кондиционных сред после культивации трансгенныхклеток .

Для каждого эксперимента трансфицированные исследуемой конструкцией клетки НЕК293 высевали в чашку Петри диаметром 3 см и культивировали в течение 72 часов в среде DMEM обогащенной глюкозой. Затем среду после культивирования клеток собирали и отфильтровали через 0,45 mm фильтр (Millipore). В качестве контрольной среды использовали среду кондиционированную 72 часовой культивацией нетрансфицированных клеток Для контроля концентрации в HEK293. GDNF кондиционированной среде использовали набор ELISA согласно протоколу (GDNF Emax Immunoassay; Promega). Для проведения цитофлуориметрического анализа клетки промывали фосфатно-солевым буфером, трипсинизировали и снимали с чашек Петри .

Затем дважды отмывали от трипсина и тщательно ресуспендировали в фосфатносолевом буфере. Полученную суспензию (10 6клеток в 1 мл буфера) переносили в 5 мл круглодонные пробирки. Напряжение каналов проточного цитофлуориметра подбиралось таким образом, чтобы аутофлуоресценция нетрансфецированных клеток не учитывалась при проведении измерений. После проведения калибровки все образцы измерялись при постоянных значениях напряжений. Так, если в клетках детектировалась флуоресценция на логарифмической шкале по EGFP, соответствующему каналу фиксировалось появление клеток в области, превышающей значение «10» и все количественные значения уровня экспрессии гена измерялись именно в этой области .

2.7.3. Культивация клеток РС12 и анализ образования отростков

Клетки линии PC12 высевали на дно 4-луночных плашек покрытое коллагеном типа 1 из хвостов крысы (Sigma, США) при плотности 3х104 клеток на лунку и культивировали 4 часа в RPMI1640 содержащей 10% лошадиной сыворотки, 2ммол/л Lглютаминовой кислоты, 100 мкг/мл стрептомицина при 37оC и 5% CO2. Затем среду заменяли на кондиционную среду, собранную после культивации трансгенных клеток .

После 3х дневной культивации в кондиционированной среде клетки PC12 фиксировали в 4% растворе формальдегида в фосфатном буфере (PBS, рН7,3) 20 минут при 4 оC, покрывали раствором антифриза (смесь глицерина, этиленгликоля и PBS), хранили при о C. Впоследствии зафиксированный материал анализировали с помощью инвертированного микроскопа Olympus IX81 снабженного цифровой камерой Olympus DP72 в фазовом контрасте. Культуры отмывали от антифриза и окрашивали иммуноцитохимически с помощью антител против 3тубулина (кроличьи, поликлональные («Abcam», UK)). При этом для блокирования неспецифического связывания ганглии инкубировали в 2% растворе нормальной сыворотки осла при комнатной температуре в течение 1 часа. Далее инкубация в первичных антителах против 3тубулина (кроличьи, поликлональные («Abcam», UK), разведенные в соотношении 1:100 раствором PBS содержащим 0,3% детергента Triton X100 (Sigma, USA) при 40С 12 ч .

После троекратной промывки в PBS материал инкубировали в растворе ослиных антител против иммуноглобулина кролика, конъюгированных с флуоресцентным красителем Су2 (Jackson Immuno Research, USA) при комнатной температуре 1ч. После троекратной промывки в PBS ганглии покрывали глицерином и анализировали с помощью инвертированного флуоресцентного микроскопа Olympus IX81. Анализ проводился при синем возбуждающем свете и желтом светофильтре (система фильтров U-MWB). На микрофотографиях сделанных в фазовом контрасте и в свете флуоресценции подсчитывали процент клеток, обладающих отростками, длина которых равна или больше наименьшего диаметра тела клетки. Подсчет клеток проводили с помощью программы Image Tool (США). Для каждой исследуемой конструкции выполняли по 5 подсчетов включающих 100-120 клеток. Результаты анализировали с помощью программного пакета SPSS .

2.7.4.Методика получения спинальных ганглиев .

Эмбрионы крысы Е15 были использованы для получения эмбриональных спинальных ганглиев. Эмбрионы помещали в 100 мм чашку Петри с рабочей средой (DMEM/F12; 2 мМ L-глутамин; 10% фетальная сыворотка коровы гентамицин – 50 мкг/мл. Приготовленная среда фильтровалась через 0.22 мкм целлюлозно-ацетатный фильтр с низким связыванием белка («Corning»). Область спинномозгового ствола с расположенными на нем ганглиями был дважды промыт раствором Хенкса (ПанЭко, Россия) с гентомицином (100 мкг/мл). Под бинокулярной лупой выделяли спинальные ганглии из мест их расположения на спинном мозге. Выделенные ганглии перекладывали в капли среды (100 мкл), нанесенной на дно 35-мм чашки Петри. Правильность выделения спинальных ганглиев проверяли под микроскопом. В другой серии экспериментов ганглии разделяли на 3-5 фрагментов и помещали в лунку фрагменты одного ганглия .

Ганглии и их фрагменты в течение первых 3-4 часов находились в ростовой среде (DMEM/ F12; 10% фетальная сыворотка крови; L-глутамин; 100 мкг/мл гентамицин; 0,8 % глюкоза; 2 мкм HEPES). После прикрепления ганглиев к субстрату, ростовую среду заменяли на кондиционированные среды с трансгенных клеточных культур .

Инкубировали в течение 10 суток (5% СО2 инкубаторе при 37С0) в 200 мкл среды .

Кондиционированные и контрольные среды меняли каждые 2-3 дня .

2.7.5. Оценка апоптоза .

Оценка апоптоза трансгенных клеточных культур: HEK293/pre-pro-GDNF/GFP, HEK293/mGDNF/GFP, HEK293/pre-GDNF/GFP, HEK293/prо-GDNF/GFP, содержащих модификации исследуемых химерных генов pre-pro-GDNF/GFP, mGDNF/GFP, preGDNF/GFP, prо-GDNF/GFP осуществляли при использовании набора для обнаружения апоптоза аннексинV – меченным стрептавидином (Trevigen 4835-01-K) в соответствии с инструкциями производителя. Анализ трансгенных культур по различным химерным генам проводили после 24-часовой инкубации в среде и подвергнутые воздействию исследуемых кондиционных сред с трансгенных клеточных линий НЕК293. После инкубации исследуемые клетки собирали, осаждали центрифугированием при скорости 2500 оборотов в минуту, далее промывали раствором 1хPBS и конъюгировали с аннексином-V. После инкубации при комнатной температуре в течение 15 мин клетки промывали раствором 1х PBS, и окрашивали конъюгатом стрептавидин-DL549 (Jackson immunoreseach). Флуоресценцию клеток оценивали при помощи проточной цитофлуориметрии на приборе Beckman Coulter Epics Altra. Результаты были получены в трех повторах .

2.7.6. Количественная оценки методом ELISA .

Секрецию фьюжн белка хGDNF/GFP из трансгенных клеток НЕК293 оценивали с использованием метода ELISA. Анализ проводился с использованием кондиционной среды трансгенных клеток HEK293/хGDNF/GFP, в качестве контроля использовалась среда после культивирования нетрансфецированных клеток НЕК293. Каждое исследование проводилось в трех повторах. Культура трансгенных клеток инкубировалась в свежем растворе DMEM, при добавлении 10% фетальной сыворотки крови, с Lглутамина и 4% гентамицина в течение 24 часов. Анализ проводился с использованием Кондиционная среда GDNF Emax® ImmunoAssay System (Promega # G7621) .

обрабатывалась Anti-GDNF (mAb). Далее, GDNF связывается со специфическим поликлональным антителом (pAb). Затем проводилась промывка в результате чего несвязанный конъюгат удалялся. Положительно окрашенный GDNF конъюгирует с антителом pAb, меченным пероксидазой (HRP). Количество GDNF в тесте пропорциональна цвету, образующегося в результате окислительно-восстановительной реакции. Таким образом, количественно определен GDNF в кондиционной среде. Для количественной оценки содержания GDNF использовался прибор многофункцианальный планштный ридер Synergy 4. Количественная оценка проведена с использованием стандартного антитела с известной концентрацией .

2.8. Иммуногистохимический анализ .

2.8.1.Иммуноцитохимический анализ спинальных ганглиев .

После 10 дней культивирования спинальные ганглии фиксировали 4% раствором формальдегида в физиологическом растворе с добавлением фосфатного буфера (PBS) при 4оС 20 минут. Фиксированные спинальные ганглии были трижды промыты по 5 минут раствором 1ХPBS. Для блокирования неспецифического связывания были использованы первичные антитела на 3тубулин (кроличьи, поликлональные («Abcam», UK), разведенные в соотношении 1:100 раствором PBS содержащим 0,3% детергента Triton X100 (Sigma, USA) и 2% нормальной сыворотки осла. Первичные антитела инкубировали при 4о С 12 ч. Первично окрашенные спинальные ганглии, были трижды промыты раствором PBS, с экспозицией по 5 минут. Окрашивание раствором вторичных антител проводилось при комнатной температуре 1 ч. В качестве вторичных антител иcпользовали ослиные антитела против иммуноглобулина кролика, конъюгированные с флуоресцентным красителем Су2 (Jackson Immuno Research, USA). Далее проводили процедуру отмывания от вторичных антител в растворе 1Х PBS три раза по пять минут .

Окрашенные ганглии покрывали глицерином и анализировали с помощью инвертированного флуоресцентного микроскопа Olympus IX81. Анализ проводился при синем возбуждающем свете и желтом запирающим светофильтре (система фильтров UMWB) .

<

2.8.2. Проведение трансплантации .

Клетки линии НЕК 293 (плотность 70-80%, 25 см2 флакон) обрабатывали версеном (5 мин) и 0,25% трипсином 3 мин при 37С. Добавляли небольшое количество культуральной среды, центрифугировали клетки со средой 5 минут, 1,5 тыс. об/мин .

Супернатант сливали, к осадку добавляли небольшое количество PBS (п.2.1.2, r), центрифугировали 5 минут, 1,5 тыс. об/мин. Супернатант сливали, к осадку добавляли 50 мкл физиологического раствора. Суспензию клеток объемом 0,5 микролитра (содержащую около 100 000 клеток) вводили микрошприцем («Hamilton») в полосатое тело взрослых (2 мес.) мышей линии СВА по координатам P 0 L 3. Трансплантацию проводили под хлорал-гидратным наркозом. В мозг животных опытных групп вводили клетки, продуцирующие химерный белок GDNF/GFP, а животным контрольных групп – клетки, содержащие GFP .

2.8.3. Иммуногистохимический анализ зоны трансплантации .

2.8.3.1.Фиксация материала .

Животных усыпляли внутрибрюшинным введением летальной дозы уретана (более 1 г/кг). Кровеносную систему промывали транскардиально сначала раствором фосфатного буфера (рН 7,4) в физиологическом растворе (PBS) а затем фиксирующим раствором: 4%ным раствором параформальдегида в PBS. Фиксированный таким образом мозг извлекали из черепной коробки и погружали в фиксирующий 4% раствор формальдегида в фосфатном буфере (рН 7,2-7,4) и держали в холодильнике при 4оС 12 часов, после чего мозг пропитывали в 30% растворе сахарозы в PBS 24 часа при 4оС. В дальнейшем мозг замораживали и готовили срезы на замораживающем микротоме. Фронтальные срезы толщиной 40 микрометров собирали по 4 серии срезов каждого животного в PBS. Затем срезы помещали в раствор антифриза и хранили при -20 оС. В дальнейшем проводили иммуногистохимическое окрашивание места введения клеток с конструкцией на GDNF, а также черной субстанции на тирозингидроксилазу .

2.8.3.2.Иммуногистохимическое окрашивание на тирозингидроксилазу .

Для окрашивания срезы после отмывки от антифриза в 3х сменах PBS (по 5 минут) помещали в раствор первичных антител: моноклональных мышиных антител против тирозингидроксилазы (monoclonal anti-tyrosine hydroxylase, T2928 Sigma USA), разведенных в соотношении 1:200 в растворе PBS с добавлением 2% нормальной сыворотки лошади, 0.3% детергента Triton X100 (Sigma USA) и 0.01% азида натрия (Sigma USA) .

В растворе первичных антител срезы содержали с перемешиванием при 4-8 оС 12 часов. Далее после троекратной промывки в PBS срезы на 1 час погружали в раствор биотинилированных антител лошади против иммуноглобулина мыши (Vector Laboratories США), разведенных PBS в соотношении 1:100 с добавлением 0,3% Triton X-100 при комнатной температуре. После этого срезы троекратно промывали в PBS и помещали в раствор ABC комплекса (Vector Laboratories, США) в PBS при разведении 1:200 также на 1 час. После троекратной промывки проводили стандартную реакцию на пероксидазу с помощью 0,03% раствора диаминобензидина (Sigma, США) в PBS с добавлением 0,01% перекиси водорода. Окрашенные срезы помещали на предметные стекла, покрывали 50% глицерином и покровным стеклом .

3.8.3.3. Подсчет тирозингидроксилаза-позитивных клеток .

Количественный анализ тирозингидроксилаза-позитивных клеток на иммуногистохимически окрашенных срезах проводили с помощью микроскопа Olympus IX81 (Япония) снабженного моторизованным предметным столиком Mrzhuser motorised stage (ФРГ) управляемый с компьютера, и цифровой фотокамерой Olympus DP72. Подсчет клеток осуществляли с монитора компьютера с использованием программы “Cell*” (Olympus Soft Imaging Solution GmbH). Сначала при малом увеличении (объектив 10х) получали обзорное изображение участка среза, с комплексом ядер среднего мозга, содержащих тирозингидроксилаза-позитивные клетки: компактную часть черной субстанции (SNC substantia nigra, compact part), вентральную область покрышки (VTA ventral tegmental area). Затем подсчитывали количество тирозингидроксилаза-позитивных клеток в тестовом квадрате, который перемещали, отслеживая его перемещение на обзорном изображении. Положение тестового квадрата со стороной 50 микрометров меняли с шагом 150 микрометров по оси Х и 100 микрометров по оси Y в пределах вентральной части среднего мозга .

Глава 3 . РЕЗУЛЬТАТЫ

3.1. Анализ экспрессии и секреции GDNF в зависимости от наличия pre- и proобластей .

Первым шагом, в исследовании был анализ влияния pre- и pro- областей на активность нейротрофического фактора GDNF .

Для решения этой задачи было создано несколько модификаций гена GDNF .

На рисунке 6 представлена нуклеотидная последовательность, соответствующая полноразмерной форме гена GDNF (pre-pro-GDNF), зеленым цветом выделена pre-область гена, желтым выделена pro-область .

Atgaagttatgggatgtcgtggctgtctgcctggtgctgctccacaccgcgtccgccttcccgctgcccgccggtaag aggcctcccgaggcgcccgccgaagaccgctccctcggccgccgccgcgcgcccttcgcgctgagtagtgactca aatatgccagaggattatcctgatcagttcgatgatgtcatggattttattcaagccaccattaaaagactgaaaaggtca ccagataaacaaatggcagtgcttcctagaagagagcggaatcggcaggctgcagctgccaacccagagaattcca gaggaaaaggtcggagaggccagaggggcaaaaaccggggttgtgtcttaactgcaatacatttaaatgtcactgact tgggtctgggctatgaaaccaaggaggaactgatttttaggtactgcagcggctcttgcgatgcagctgagacaacgta cgacaaaatattgaaaaacttatccagaaatagaaggctggtgagtgacaaagtagggcaggcatgttgcagacccat cgcctttgatgatgacctgtcgtttttagatgataacctggtttaccatattctaagaaagcattccgctaaaaggtgtggat gtatc Рисунок.6 Нуклеотидная последовательность гена GDNF (GenBank: CR541923.1) .

Строение гена нейротрофического фактора включает в себя область нуклеотидной последовательности соответствующей сигнальному пептиду (57пн)), (pre-область последующая за ним область pro региона (174пн) и область зрелого GDNF представлена 402пн. Мы синтезировали несколько модификаций гена GDNF, каждая из которых отличалась наличием или отсутствием комбинаций pre- и pro- областей (Рисунок 7) .

Рисунок.7 Схематическое изображение генно-инженерных конструкций, выполненных на основе вектора pEGFP-N1 и содержащих хGDNF .

Для анализа экспрессии и секреции GDNF в зависимости от наличия pre- и proобластей были синтезированы генетические конструкции на основе вектора pEGFP-N1 .

Все конструкции были построены по принципу хGDNF–фьюжн-GFP для визуализации трансгенных клеток, несущих исследуемый ген. Последовательность гена нейротрофического фактора человека GDNF была синтезирована с помощью ПЦР на основе плазмиды phGDNF, для этого была использована первая изоформа Р39905-1 согласно базе данных UniProtKB Р39905. Для синтеза были использованы коммерческие праймеры Т3 (прямой) и GDNF (обратный) (последовательность праймеров BamH1 представлена в главе материалы и методы), полученный pre-pro-GDNF соответствовал искомому размеру. Данный фрагмент был встроен в коммерческий вектор pGEM-T Easy (Promega #1360), согласно протоколу. Полученная конструкция pGEM/ pre-pro-GDNF была проверена на наличие вставки с помощью рестрикции по сайту EcoRI в соответствующем буфере согласно протоколу и методом секвенирования. Фрагмент размером 633пн из конструкции содержащий ген pGEM/ pre-pro-GDNF, нейротрофического фактора GDNF был встроен в вектор рEGFP-N1 по сайтам рестрикции XhoI/BamHI. Ген был встроен в рамку считывания зеленого флуоресцентного белка GFP .

Полученная конструкция pre-pro-GDNF/ рEGFP-N1 была проверена методами рестриктного анализа и секвенирования. В результате получен химерный ген pre-proпн) под контролем (цитомегаловирусного) промотора .

GDNF/GFP CMV Аналогичным образом при использовании метода ПЦР амплификации с определенными праймерами были получены фрагменты mGDNF, pre-GDNF, pro-GDNF. Данные фрагменты были встроены в вектор pGEM-T Easy с последующим переклонированием в вектор pEGFP-N1 по сайтам рестрикции HindIII / BamHI, XhoI/BamHI, XhoI/BamHI соответственно. В результате были получены химерные гены mGDNF/GFP (1158пн), preGDNF/GFP (1215пн) и pro-GDNF/GFP (1335 пн). (Рисунок.8) .

Таким образом, первая конструкция содержала ген pre-pro-GDNF. Вторая - proGDNF, с делетированной pre-областью. Третья конструкция содержала pre-GDNF, где была исключена pro-область, и добавлен новый старт-кодон с примыкающей последовательностью Kozak – CCACCATG. Четвертая конструкция была получена с использованием mGDNF, в которой исключены pre- pro- области и добавлен новый старткодон с примыкающей последовательностью Kozak – CCACCATG .

Рисунок. 8 Схемы генно-инженерных конструкций pre-pro-GDNF/pEGFP-N1, mGDNF/ pEGFP-N1, pre-GDNF/ pEGFP-N1, pro-GDNF/pEGFP-N1 .

Правильность конструкций была подтверждена методами рестриктного анализа, а также сиквенированием с использованием универсальных праймеров M13 (обратный) и M13 (прямой). Каждая из конструкций была трансфецирована в клетки линии НЕК293 и получены устойчивые трансгенные культуры .

Трансфекция проводилась с использованием реагента ExGene 500, с последующей селекцией трансфецированных клонов на антибиотике гиницитине G418. В ходе получения трансгенных культур было обнаружено, что трансгенная клеточная культура HEK293/pre-pro-GDNF/GFP не дает свечения фьюжн зеленого флуоресцентного белка

GFP на С-конце. При этом остальные трансгенные клеточные линии:

HEK293/mGDNF/GFP, HEK293/pre-GDNF/GFP, HEK293/prо-GDNF/GFP, такое свечение обнаруживают. С помощью цитофлуориметра была проведена оценка интенсивности визуально невидимого свечения HEK293/pre-pro-GDNF/GFP и наиболее светящейся культуры HEK293/mGDNF/GFP. На рисунке 9А представлены результаты исследования .

Было обнаружено, что культура клеток подверженная трансфекции плазмидной ДНК, содержащей ген pre-pro-GDNF с фьюжн GFP дает только 7% позитивного окрашивания GFP трансгенных клеток, тогда как культура клеток, содержащая в своем составе mGDNF с fusion GFP дает 46% GFP трансгенных клеток. На рисунке 9 Б представлены результаты визуализации свечения в культуре .

Рисунок. 9 А-Результаты измерения концентрации зеленого флуоресцентного белка при помощи цитофлуориметра. Для анализа использовали антитела против GFP (мышиные моноклональные антитела, MAB2510 Millipore, титр 1:1000); Б- Фотографии культуры клеток НЕК293, после трансфекции конструкциями и pre-pro-GDNF/pEGFP-N1 mGDNF/pEGFP-N1. 48 часов культивирования после трансфекции .

Итак, трансгенные клетки, содержащие pre-pro-GDNF/рEGFP-N1 экспрессируют фьюжн белок GDNF/GFP с активным GDNF, и не визуализируемым GFP. Экспрессию химерных белков в трансфецированных клетках мы подтвердили с помощью Вестернблот гибридизации с использованием антител как к GFP, так и к GDNF. При использовании антител к GFP, был подтвержден результат, полученный при визуальном анализе. Гибридизация отсутствовала с pre-pro-GDNF/GFP, в то время, как остальные химерные белки гибридизовались с антителами к GFP. (Рисунок 10) .

Рисунок 10. Вестерн-блот анализ лизата трансгенных клеток НЕК 293 с антителами против GFP (мышиные моноклональные антитела, MAB2510 Millipore, титр 1:1000). 1контроль, мозг трансгенной мыши по GFP; 2- НЕК 293; 3 - HEK293 с mGDNF/ GFP; 4 НЕК 293 с pre-pro-GDNF/GFP; 5 - HEK293 с pre-GDNF/GFP; 6 - HEK293 с prо-GDNF/GFP 7 - HEK293 с GFP .

Положительным контролем служил экстракт из мозга трансгенной по GFP гену мыши, отрицательным контролем служила гибридизация с клеточным лизатом нетрасфецированных клеток НЕК293. Далее клетки НЕК293, продуцирующие трансгенные fusion белки были проанализированы методом Вестерн-блот гибридизации с использованием антител к GDNF. Было обнаружено, что все конструкции синтезируют химерные белки GDNF/GFP. Следует отметить, что во всех экспериментах pre-GDNF/GFP синтезировался значительно менее интенсивно по сравнению со всеми остальными фьюжин белками. Также нужно обратить внимание, что подвижнорсть pre-pro-GDNF соответствовала подвижности фьюжн белка pre-pro- GDNF/GFP (рисунок 11) .

Рисунок 11. Вестер-блот гибридизация лизата трансгенных клеток с антителами против GDNF (кроличьи поликлональные антитела, Santa Cruz D-20): 1- контроль, мозг трансгенной мыши по GFP; 2- Нек 293 с pre-pro-GDNF/GFP 3 - HEK293 с mGDNF/ GFP; 4

- HEK293 с pre-GDNF/GFP ; 5 - HEK293 с pro-GDNF/GFP; 6 - HEK293 .

Для анализа секреции химерных белков в культуральную среду была проведена Вестерн-блот гибридизация кондиционных сред, полученных после культивации трансгенных клеток, с использованием антител к GDNF. Нами было показано, что все четыре химерных белка секретировались из клеток в среду (рисунок 12) .

Рисунок 12. Вестер-блот гибридизация кондиционных сред, полученных после культивации трансгенных клеток, с антителами против GDNF (кроличьи поликлональные антитела, Santa Cruz D-20): 1- Контроль –среда НЕК 293; 2 - контроль, лизат мозга мыши;

3- среда с НЕК 293, с mGDNF/GFP; 4- среда с НЕК 293 с pro-GDNF/GFP; 5- среда с НЕК 293 с pre-pro-GDNF/GFP; 6- среда с НЕК293 с pre-GDNF/GFP .

На основании полученных данных можно сделать следующие выводы. Во-первых, у полученных модификаций GDNF/GFP, у которых удалены либо pro-область, либо prеобласть, либо обе эти области одновременно, не выявлялось нарушений секреции фактора из трансфицированных клеток в среду. Следует обратить внимание, что даже удаление prе-области, которая кодирует сигнальную последовательность белка не мешает транспорту химерного белка из клетки в среду. Во-вторых, при исследовании клеток с химерным белком полноценного prе-pro-GDNF с GFP обнаруживалось нарушение флуоресцентного свечения GFP. При анализе этого белка Вестерн-блот гибридизацией было показано, что химерный белок присутствовал в ожидаемом размере (prе-pro-GDNF + GFP), но отсутствовала гибридизация с антителами к GFP. Попадая в аппарат Гольджи GFP- «хвост» вероятнее всего подвергается гликозилированию. Подобные эффекты были описаны в работах Huang и Li с соавторами. (Huang et al.,2005; Li et al., 2002) Для исследований способности химерных белков стимулировать нейральную дифференцировку использовали три клеточные модели: цельный эмбриональный спинальный ганглий крысы, диссоциированный эмбриональный спинальный ганглий крысы и клетки феохромоцитомы крысы РС12. Для анализа использовалась кондиционная среда, полученная после культивирования трансгенных клеток НЕК293, содержащая равные концентрации химерных белков. Отрицательным контролем служила кондиционная среда, полученная после культивации трансгенных клеток НЕК293 с GFP .

Для определения концентрации химерных белков в кондиционных средах использовалась Вестерн-блот гибридизация с антителами против GDNF и метод ELISA .

Было показано, что при культивации трансгенных клеток НЕК293, хGDNF/GFP секретируется в среду. Интенсивность секреции mGDNF/GFP значительно превышала секрецию полноразмерного продукта рre-рro-GDNF/GFP (рисунок 13). Кроме того, можно утверждать, что количество mGDNF в кондиционной среде значительно превышает количество полноразмерного продукта pre-pro-GDNF/GFP. Различия в результатах экспериментов достоверны .

Рисунок 13. Количественный анализ GDNF в кондиционной среде после культивации трансгенных клеток НЕК293 методом ELISA .

HEK293 – оценка количества GDNF после культивации нетрансгенных клеток НЕК293;

– оценка количества после культивирования HEK293/pre-pro-GDNF/GFP GDNF трансгенных клеток НЕК293 с pre-pro-GDNF/GFP; HEK293/mGDNF/GFP – оценка количества GDNF после культивирования трансгенных клеток НЕК293 с mGDNF/GFP .

Затем нами была подобрана концентрация для mGDNF/GFP, как наиболее интенсивно секретируемой изоформы. Для этого кондиционная среда объемом 1 мл, содержащей mGDNF/GFP, была сконцентрирована до объема 50 мкл и проанализирована методом Вестерн-блот гибридизацией в сравнении с recGDNF (1,25; 2,5; 5 и 10 ng) (рисунок 14). Таким образом, было определено, что при исследовании нейральной активности химерных белков используется концентрация примерно 1,25 ng .

Рисунок 14. Вестерн-блот анализ с использованием поликлональных антител против 1- Маркер используемый для детекции (PageRuler Prestained Protein Ladder GDNF .

SM0671). 2- Кондиционная среда с НEK293 с mGDNF/GFP 3- лизат клеток HEK293 с

mGDNF/GFP; 4-7 Разведение рекомбинантного GDNF (recGDNF) (Pepro-tech 450-10B):

1,25 ng, 2,5 ng, 5 ng, 10 ng, соответственно .

На основании полученных результатов концентрации всех изучаемых химерных белков были выровнены для дальнейших исследований их эффективности .

Далее было доказано, что трансгенные нейротрофические факторы попадают в среду именно в результате секреции, а не по причине гибели клеток. Для этого был проведен анализ на апоптоз трангенных клеток. На рисунке 15 представлен результат анализа на апоптоз трансгенных клеток с который не имел сигнальной prо-GDNF/GFP, последовательности и секретировался в среду в самой меньшей концентрации из всех полученных химерных белков .

Рисунок 15. Анализ апоптоза трансгенных клеток.a, b- трансгенная линия клеток НЕК293, содержащая prо-GDNF/GFP .

Результаты получены методом проточной цитометрии. Культура клеток НЕК293/pro-GDNF/GFP была проанализирована спустя 24 часа. Для исследования апоптоза трансгенные клетки были обработаны аннексином-V, меченным стрептавидином (streptavidin DL549). Известно, что аннексин-V с высокой аффинностью связывается с экспонированным на поверхности апоптотических клеток фосфатидилсерином и ингибирует прокоагулянтную и провоспалительную активности гибнущих клеток. В качестве контроля использовались также трансфецированные клетки HEK293/prоGDNF/GFP не окрашенные аннексином-V. Данные цитофлуориметра представленные на рисунке демонстрируют низкий процент клеток, уходящих в апоптоз. На рисунке 20b показаны результаты проточного цитофлуориметра клеток НЕК293, культивируемых в течение 24 часов с кондиционной средой, содержащей pro-GDNF/GFP. Данный эксперимент был выполнен для того, чтобы проанализировать возможность апоптотического влияния добавленного в среду pro-GDNF/GFP на клетку. Мы также не обнаружили подобного негативного влияния pro-GDNF/GFP на увеличение апоптотических процессов в клеточной культуре. Эксперименты были выполнены в трех повторах. По результатам анализа можно сделать вывод, что ни трансфекция, ни инкубация в кондиционированной среде с химерными белками не вызывают апоптоз. Иммуноцитохимическое исследование также подтверждает эти результаты. Флуоресцентная микроскопия анализируемых клеточных культур не показали значительного количества апоптоза клеток .

Для изучения эффективности свойств трансгенного GDNF, как индуктора нейральной дифференцировки, была использована линия клеток PC12 (линия клеток феохромоцитомы крысы) .

Подобная модель считается стандартной и общепринятой при исследовании нейральных индукторов. Опухолевая клеточная линия PC12 была получена в 1976 г. из хромаффинных клеток мозгового вещества надпочечников. Особенностью этих клеток является их способность в ответ на нейральные индукторы дифференцироваться в нейроподобные клетки. Четкой характеристикой такого ответа является образование отростков .

Так как в норме клетки РС12 не образуют отростков, то появление отростков и их длина являются достаточными характеристиками для утверждения того, что добавляемый в среду фактор является нейральным индуктором. В нашем случае клетки РС12 изучались на способность образовывать нейральные отростки после воздействия кондиционной среды с содержанием нейротрофического фактора GDNF с делетированными pre-proобластями. Для этого культура трансгенных клеток НЕК293 рассевалась на площади 25см2, по достижению конфлюентности около 60% от общей площади, полная среда была заменена на среду DMEM, не содержащую фетальную сыворотку. Через 72 часа культивирования при 37С0 кондиционную среду с клеток собирали и профильтровывали через 0,22 нм фильтр. Клетки линии PC12 высевали на дно 4-луночных плашек покрытое коллагеном типа 1. Затем среду культивирования клеток заменяли на PC12 кондиционированную среду, полученную после культивации трансгенных клеток с HEK/mGDNF/GFP. В качестве контроля использовали кондиционированную среду, полученную после 72 часовой культивации нетрансфицированных клеток HEK293. После 3х дневной культивации в кондиционированной среде клетки PC12 фиксировали в 4% растворе формальдегида и анализировали. Было обнаружено, что после 3х-дневного культивирования клеток линии PC12 с кондиционной средой, содержащей химерные нейротрофические факторы, доля клеток с отростками (превышающими размеры тела) значительно и достоверно превышала этот показатель в контрольных культурах (рисунок 16, 17) .

Наибольший процент клеток с отростками зафиксирован у клеток культивированных в кондиционированной среде, полученной с трансгенной клеточной культуры HEK293/mGDNF/GFP. Различия между контрольными культурами, которые прокультивированны в кондиционированной среде с нетрансфицированной культурой клеток HЕК293 и в некондиционированной среде, достоверны согласно одностороннему анализу ANOVA .

Рисунок 16. Процентное содержание клеток с отростками в культурах PC12 после культивирования в средах, с химерными белками и в контрольных средах. RecGDNF рекомбинантный GDNF в концентрации 10 мкг/мл микрограмм в мл; mGDNF/GFP кондиционнированная среда, полученная с трансгенной клеточной линии HEK293/mGDNF/GFP; pre-GDNF/GFP - кондиционнированная среда, полученная с трансгенной клеточной линии HEK293/pre-GDNF/GFP; pro-GDNF/GFP кондиционнированная среда, полученная с трансгенной клеточной линии HEK293/prоGDNF/GFP .

В ходе исследований было показано, что в контроле не образовывались отростки, что соответствует ожиданиям отсутствия нейральных характеристик у клеток РС12 без добавления индукторов (рисунок 17). Так как pre-pro-GDNF/GFP показал аномалию свечения GFP (отсутствие результативной полосы при Вестерн-блот гибридизации и отсутствие свечения), а, следовательно, возможны изменения индукторных свойств при исследовании, то в качестве положительного контроля кондиционированная среда с линии НЕК293/pre-pro-GDNF/GFP была заменена на рекомбинантный GDNF (recGDNF) с известной концентрацией. Данный рекомбинантный белок фирмы Pepro-tech (Catalog Number: 450-10B) является полным аналогом изоформы pre-proGDNF человека. В качестве положительного контроля мы использовали recGDNF, чтобы оценить процесс дифференцировки. При добавлении среды с prе-GDNF/GFP через 4 дня появлялись короткие отростки, что говорит о том, что фактор обладает незначительной нейральной индукторной способностью (рисунок 17). При добавлении среды с mGDNF/GFP на четвертые сутки обнаруживались длинные ветвистые отростки, что говорит о значительных свойствах этого химерного белка, как нейрального индуктора (рисунок 17) .

Следует обратить внимание, что кондиционная среда с mGDNF/GFP давала наиболее интенсивное образование нервных отростков. Однако, при добавлении среды с proGDNF/GFP отростков к культуре клеток РС12 не наблюдалось. Данное исследование было подтверждено как подсчетом длины отростков по отношению к телу клетки (рисунок16), так и окраской на III-тубулин, что подтверждает нейральную характеристику отростков (рисунок17) .

Рисунок 17. Эффективность воздействия кондиционных сред с хGDNF/GFP на клетки РС12. Окрашивание на III-тубулин: HEK293/mGDNF/GFP; HEK293/pre-GDNF/GFP;

HEK293/prо-GDNF/GFP, положительный контроль - recGDNF; отрицательные контроли кондиционная среда с не трансгенных НЕК293 (HEK) и среда DMEM (Среда) .

Для изучения эффективности свойств трансгенных химерных белков GDNF была использована модель культивирования цельного эмбрионального спинального ганглия крысы. Из литературных данных известно, что потенциальной мишенью для действия GDNF выступают нейроны задних корешков (DRG) эмбриональных крыс. (Henderson CE, et al., 1994; Trupp M, et al., 1995; Sapio MR, et al., 2016). Для эксперимента брались спинальные ганглии 15 –дневных эмбрионов крысы. Эмбриональные спинальные ганглии помещали (по 3 спинальных ганглия) в 4-х луночные плашки на полиэтилениминовом субстрате и инкубировали в течение 30 мин с промыванием дистиллированной водой 3-4 раза. Далее ганглии в течение последующих 3-4 часов находились в ростовой среде (DMEM F12, 10% FCS). После прикрепления к субстрату ростовую среду убирали и заменяли на кондиционированную среду, полученной после культивации трансгенных линий клеток HEK293/mGDNF/GFP, HEK293/pre-GDNF/GFP, HEK293/prо-GDNF/GFP. В качестве отрицательных контролей были использованы 1. кондиционная среда с нетрансгенных HEK293 и 2. ростовая среда. Инкубировали в течение 10 суток (5% СО2, 37С0) в 200 мкл среды, среды менялись каждые 2-3 дня .

Первые отдельные отростки обнаруживались уже через 12 часов после помещения в кондиционированную среду с mGDNF/GFP. Далее с разной интенсивностью отростки появлялись у эмбриональных спинальных ганглиев крысы культивированных с добавлением recGDNF, а также кондиционной среды с pre-GDNF/GFP. При росте интервала времени культивирования количество отростков увеличивалось, а также увеличивалась их длина. Следует отметить, что при использовании кондиционной среды с отростки не образовывались. Для подтверждения нейральных prо-GDNF/GFP характеристик данных отростков был проведен иммуноцитохимический анализ с окрашиванием антителами к IIIтубулину. IIIтубулин, экспрессируется во время дифференцировки нейрональных типов клеток. Иммуногистохимическое окрашивание на IIIтубулин обнаруживается в соме, дендритах, аксонах и окончаниях аксонов незрелых нейронов. Одним из существенных преимуществ, связанных с использованием иммуногистохимического детектироания IIIтубулина, является степень, с которой он раскрывает мелкие детали аксонов и окончаний, что в нашем исследовании является необходимым при понимании природы отростков клетки. Кроме того, данный маркер является классическим маркером нейробластов (незрелых нейронов). Для окрашивания культуры клеток фиксировали 4% раствором параформальдегида на фосфатном буфере 30 мин при 4оС. Затем после троекратной помывки в PBS культуры иммуноцитохимически окрашивали с помощью антител к маркеру нейрональных структур III-тубулин. При окраске на IIIтубулин использовали кроличьи поликлональные антитела, разведенные в соотношении 1:100 раствором PBS содержащим 0,3% детергента Triton X100 и 2% нормальной сыворотки осла для блокирования неспецифического связывания. Процедура окраски описана в главе «Материалы и методы» .

В экcпериментах с цельными эксплантатами спинальных ганглиев были выявлены значительные различия в интенсивности роста волокон нервных клеток ганглиев между культурами, на которые воздействовали кондиционными средами с тремя из исследованных форм хGDNF/GFP (mGDNF, recGDNF, pre-GDNF (рисунок 18 (a,b,c)), и культурами на которые воздействовали кондиционной средой с pro-GDNF (рисунок 18е), или контролями (рисунок 18d). Удивительно, что не было обнаружено ни одного отростка после воздействия кондиционной среды с pro-GDNF/GFP. Таким образом, можно утверждать, что pro-GDNF/GFP экспрессируется в трансгенных клетках НЕК293, секретируется в среду, но не обладает нейральными индукторными свойствами. Ганглии контрольной группы после 10-дневной культивации в питательной среде не давали IIIтубулин-позитивных отростков (рисунок 18е). Ганглии, культивировавшиеся в присутствии mGDNF, RecGDNF и pre-GDNF демонстрировали интенсивный рост IIIтубулин-позитивных отростков.Окраска на IIIтубулин говорит о том, что отростки имеют нейральные характеристики. Ветвления начинались в большинстве случаев в 150микрометрах от границы ганглия. Результаты в виде флуоресцентных микрофотографий представлены на рисунке 18 .

Рисунок 18. Влияние кондиционных сред, содержащих химерные белки хGDNF/GFP на образование нейральных отростков у эмбрионального спианального ганглия крысы .

Иммуноцитохимическая реакция на IIIтубулин. Флуоресцентные микрофотографии спинального ганглия прокультивированного 10 дней в присутствии кондиционной среды с трансгенных клеточных линий a- HEK293/mGDNF/GFP, b - рекомбинантный GDNF (recGDNF)c- HEK293/pre-GDNF/GFP, d HEK293/GFP – (контроль); e- HEK293/prоGDNF/GFP. Видны многочисленные волокна нервных клеток ганглия, ветвящиеся на дне культуральной чашки. Масштаб справа внизу – 200 микрометров .

Эксперимент с цельными спинальными ганглиями показал, что mGDNF является самым активным стимулятором нейрональной дифференцировкиу клеток.Для количественной оценки эффективности воздействия хGDNF/GFP на образование нейральных отростков у эмбрионального спинального ганглия крысы был использован метод анализа диссоциированного спинального гаглия. Клетки диссоциированных эмбриональных спинальных ганглиев помещались в 4 –луночные плашки по 50 000 клеток на лунку. Далее проводилась инкубация с добавлением кондиционированных сред, содержащих один из факторов mGDNF/GFP, pre-GDNF/GFP, prо-GDNF/GFP, при этом концентрации факторов в среде были выровнены. Клетки располагались на дне культуральных чашек поодиночке или группами. Часть клеток позитивно окрашивались на III-тубулин (рисунок 19). На рисунке 19 показаны результаты исследования культур клеток диссоциированного спинального ганглия, инкубированных с добавлением одной из трех кондиционированных сред используемых в эксперименте, для отрицательного контроля использовалась кондиционная среда, полученная после культивации не трансгенных клеток HEK293, для положительного — recGDNF. Для подтверждения нейральной природы отростков использовали иммуногистохимическую окраску при помощи антител к III-тубулин. Клетки в контрольных культурах (рисунок 19) а также в культурах, инкубированных с кондиционной средой, содержащей pro-GDNF/GFP (рисунок 19d) не давали отростков позитивно окрашенных на IIIтубулин. В культурах, инкубированных с кондиционированными средами, содержащими pre-GDNF/GFP (рисунок 19b), и mGDNF/GFP (рисунок 19с), а также в культурах в среду культивирования которых добавляли rec GDNF (рисунок 19а) наблюдалось большое количество IIIтубулин иммунопозитивных отростков у клеток. Клетки в этих культурах образовывали длинные ветвящиеся III-тубулин позитивные отростки. Для оценки эффективности влияния pre-GDNF/GFP, mGDNF/GFP и recGDNF на интенсивность образования нейральных отростков у клеток диссоциированного эмбрионального ганглия крысы использовался подсчет отростков при помощи рамки с двумя радиусами Мерца (Lipton et al., 2008). Пример рамки представлен на рисунок 19е. Рамка Мерца общепризнанный метод количественного анализа образования нейральных отростков. Использование рамки Мерца позволяет получить точные и достоверные показатели общего количества клеток, средней длины невритов и средней степени ветвления нейронов. Рамка Мерца представляет собой стандартизированный контур для количественной оценки вышеупомянутых показателей. Рамка имеет синусоидальный радиус размером 50 мкм, сетку 400х400 мкм и счетную рамку 200х200 мкм. (Lipton et al., 2008). Ядра клеток, касающиеся двух синих сторон рамки, считались, касающиеся красных - не считались .

Все пересечения отростков с двумя радиусами Мерца (изображены желтыми линиями) подсчитывались. Если один и тот же аксон пересекал желтую линию дважды, все пересечения учитывались. Количество пересечений нервных отростков с рамкой Мерца было нормализовано по числу нейронов, позитивно окрашенных на III-тубулин. Данные этих измерений показывают, что три исследованные формы GDNF (recGDNF, preGDNF/GFP и mGDNF/GFP) позитивно воздействуют на длину отростков. При этом интенсивность воздействия pre-GDNF/GFP и mGDNF/GFP значительно превышает таковую рекомбинантного GDNF (Рисунок 19f). Следует обратить внимание, что mGDNF/GFP обладал наивысшей способностью стимулировать образование нейральных отростков у клеток эмбрионального спинального ганглия. Данные результаты полностью совпадают с результатами, полученными в экспериментах с цельными эмбриональными спинальными ганглиями крысы .

Рисунок 19. Эффект воздействия кондиционной среды, содержащей химерные белки хGDNF/GFP на клетки культуры диссоциированного эмбрионального спинального ганглия крысы.a- положительный контроль, добавление rec GDNF. b- среда с pre-GDNF/ GFP. c- среда с mGDNF/GFP. d- среда с pro-GDNF/GFP. e- рамка с радиусами Мерца для подсчета отростков. (Jack W. Lipton et al., Neuropharmacology. 2008), наложенная на фотографию культуры клеток спинального ганглия.f- Средняя длина аксона нейрона оцененная как соотношение общего количества длин аксона, к числу нейронов.recGDNF (p0,01), pre-GDNF/gfp (p0,05), mGDNF/gfp (p0,01), соответственно. Представленные данные являются средним ±SD (где (n=5 в каждой группе). Масштаб в a–d - 500 m, Масштаб в e - 200 m .

Рисунок 20. Культура клеток диссоциированного эмбрионального спинального ганглия, инкубированная в ростовой среде (отрицательный контроль) .

Таким образом, нами было обнаружено, что белок pro-GDNF при секреции в среду не стимулирует образование отростков в культуре клеток спинального ганглия, и не стимулирует нейральную дифференцировку (образование бета-3-тубулин-позитивных отростков). При этом ганглии, культивировавшиеся в присутствии продуктов pre-GDNF и m-GDNF демонстрируют интенсивный рост бета-3-тубулин-позитивных отростков .

Следует отметить, что при сохранении сигнальной последовательности и удалении proобласти (pre-GDNF) фактор секретировался в среду и обладал несколько сниженными трофическими свойствами, соизмеримыми, все же, со свойствами recGDNF. Вероятно, удаление pro-области, не влияло на индуктивные способности фактора, значительно снижает активную секрецию фактора из клеток.Удаление же pre- и pro-областей (mGDNF) удивительным образом не влияло на транспорт данной модификации из клетки и улучшало индукционные свойства фактора. На основании экспериментально полученных данных нами сделан вывод, что GDNF может обходиться без сигнальной preобласти только в случае отсутствия и pro-области, т.к. секреция GDNF c делетированной сигнальной pre- и pro-областью успешно происходит, а также подобный фактор стимулирует нейральную дифференцировку клеток. Следует обратить внимание, что делеция только pre-области у GDNF (без удаления prо-области) резко блокирует нейропротекторные свойства фактора. Возможно, подобный эффект может быть связан с изменением пути секреции фактора в зависимости от наличия или отсутствия pro-области .

M. Saarma показал, что уменьшение размера pro-области GDNF направляет секрецию белка GDNF через систему везикул, минуя аппарат Гольджи. Таким образом, можно предположить, что выбор пути секреции GDNF связан с pro-областью. (LonkaNevalaita L et al., 2010) .

Полученные результаты свидетельствуют о том, что поиск и разработка новых модификаций может привести к созданию более эффективных GDNF геннотерапевтических препаратов, способных оказывать позитивное воздействие на прогениторные клетки при терапии нейродегенеративных заболеваний или других нарушений приводящих к гибели нейронов .

Далее были проведены эксперименты на модели in vivo. Для исследования был использован mGDNF, как наиболее активная форма. В экперименте были введены трансгенные клетки линии НЕК293, экспрессирующих модификацию нейротрофического фактора mGDNF в мозг мышей с последующим системным введением нейротоксина МФТП (1-метил-4-фенил-1,2,3,6-тертрагидропиридин), моделирующего нарушения при болезни Паркинсона. Ключевой патогенетический механизм МРТР - индуцированного синдрома обнаруживает принципиальное сходство с патогенезом болезни Паркинсона .

Основной мишенью нейротоксина является чёрная субстанция. Эксперименты проведены на 10 мышах линии C57BL/6 в возрасте 2,5-3 месяцев и массой 25-30г. (Sedelis et al., 2001;

Tillerson et al., 2002). Мы использовали дозу токсина 40 мг/кг подкожно для воссоздания клинической стадии БП. Контрольная группа животных вместо токсина получала раствор 0,9% NaCl.

В эксперименте было выделено четыре группы животных:

1. Животные, которым за 3 дня до инъекции MPTP инъецировали трансгенные клетки HEK293/mGDNF/GFP .

Животные, которым за 3 дня до инъекции MPTP инъецировали клетки 2 .

HEK293/GFP .

3. Контрольные животные без введения (нормальная мышь) .

4. Животные, которым вводили без предварительной инъекции MPTP трансгенных клеток .

Трансгенные клетки HEK293/mGDNF/GFP были инъецированы в стриатум мышей (группы 1 и 3) линии C57BL/6j. Для этого суспензию около 150.000 клеток в объеме 1 микролитра раствора Хенкса вводили билатерально в мозг. Введение производили медленно (в течение 3 минут) с помощью микрошприца через отверстия с координатами АР-0, ML-2.5 (область хвостатого ядра/скорлупы). Иглу микрошприца погружали на глубину 2.5 мм с последующим ступенчатым вводом суспензии клеток по мере обратного хода иглы до глубины 1.5 мм. Таким же образом вводили клетки HEK293/ GFP животным 2-й группы .

Для убедительности улучшения моторной координации мышей после использования трансгенных клеток с mGDNF был использован анализ удерживания животных на ротароде. В экспериментах мыши всех групп удерживались на ротароде при скорости вращения 6 об/мин. При увеличении скорости вращения были выявлены значительные и достоверные различия между группами в скорости, на которой животные падали с барабана. Мыши 1-й группы, которым перед введением пронейротоксина вводили в стриатум клетки HEK293/mGDNF/GFP, экспрессирующие модификацию показывали достоверно лучший результат, выдерживая скорость 21 mGDNF оборотов/мин, в то время как мыши 2-й и 4-й групп, которым в тех же условиях вводили клетки, не содержащие этого гена, или совсем не вводили клеток падали уже при скорости 12-14 об/мин (рисунок 21). Результаты первой группы достоверно отличались от результатов 4й и 2й групп (p0.05). Третью группу животных не тистировали на барабане .

–  –  –

Рисунок 21. Результаты тестирования на ротароде мышей 1-й (mGDNF+MPTP, N=5), 2-й (НЕК293+MPTP, N=10) и 4-й (MPTP, N=11) групп. Цифры на столбиках – номера групп. По оси ординат – пороговая скорость вращения стержня, нормализованная по 4-й группе (100%), при которой наблюдалось падение животного в течение 30секундной экспозиции (M±SE; отличие от 4-й (MPTP) группы: *p0.05) .

Затем животное вновь наркотизировали и перфузировали через сердце физиологическим раствором на фосфатном буфере (PBS), а затем 4% раствором формальдегида в PBS. Головной мозг извлекали и фиксировали (см. описание выше) .

Коронарные срезы среднего мозга и стриатума толщиной 40, микрометров получали на замораживающем микротоме и собирали в PBS. Было собрано по 4 серии срезов каждого мозга. Каждый 4-й срез, содержащий черную субстанцию среднего мозга, иммуногистохимически окрашивали на тирозингидроксилазу (TH) (рисунок 22) .

Рисунок 22. Билатеральная трансплантация клеток содержащих трансген mGDNF предотвращает гибель нейронов черной субстанции и VTA вызванную инъекцией MPTP .

Репризентативные микрофотографии коронарных срезов вентральной части среднего мозга мыши получившей только инъекцию MPTP (А), нормальной мыши (B), трансплантацию HEK293/mGDNF/GFP за 3 дня до инъекции MPTP (C), трансплантацию HEK293/GFP за 3 дня до инъекции MPTP .

Количественный анализ TH-иммунопозитивных (TH+) клеток проводили с помощью микроскопа Olympus IX81, снабженного моторизованным предметным столиком Mrzhuser motorised stage управляемого с компьютера, и цифровой фотокамерой Olympus DP72. Подсчет клеток осуществляли на мониторе компьютера с использованием программы “Cell*”. Для исследования влияния эффективности воздействия трансгенных клеток с mGDNF на сохранность дофаминэргических нейронов черной субстанции мышей проводили подсчет тирозингидроксилаза иммунопозитивных клеток в компактной части этого ядра. Для анализа использовали срезы среднего мозга подопытных животных. В данном эксперименте было собрано по 6 серий срезов каждого мозга. Таким образом, в каждую серию срезов попадал каждый 6-й срез. Промежуток между соседними срезами в серии равнялся 240 микрометров. Срезы помещали в антифриз и хранили при -20оС до процедуры окрашивания. После окраски подсчитывали количество ядер тирозингидроксилаза-иммунопозитивных клеток в тестовом квадрате в соответствии со стандартными критериями подсчета. Клетку, окрашенную на тирозингидроксилазу включали в подсчет, если ее ядро лежало внутри тестового квадрата или касалось двух его смежных сторон (рисунок 23) и не касалось двух других сторон отмеченных на рисунке более толстым контуром. Так как просчитываемая фракция объема исследованной области мозга составляла 1/24 исследуемого объёма, для определения общего количества тирозингидроксилаза-позитивных клеток подсчитанное количество умножали на 24. Подсчитывали количество тирозингидроксилазаиммунопозитивных клеток, лежащих в пределах компактной части черной субстанции .

Рисунок 23. Срез мозга мыши, окрашенный на тирозингидроксилазу, с наложенным тестовым квадратом. Зелеными стрелками помечены ядра клеток, влюченные в подсчет, красной стрелкой — ядро исключенной клетки .

Исследование срезов животных через 17 дней после инъекции 40мг/кг MPTP, показало значительные и достоверные различия в количестве дофаминэргических нейронов в черной субстанции между контрольными и опытной группами животных (рисунок 24, Таблица 2). В контрольных экспериментах с инъекцией только MPTP было показано значительное и достоверное снижение числа ТН+ нейронов в вентральной части среднего мозга. В SNc число ТН+ нейронов уменьшилось на 78%, а в VTA — на 54% по сравнению с контролем при суммарном снижении на 67% ТН+ нейронов (Таблица 2) .

Количество ТН+ нейронов в этих структурах среднего мозга у животных, получивших трансплантацию клеток с конструкцией содержащей ген GDNF с делетированными сигнальными последовательностями (HEK293/mGDNF/GFP +MPTP) было значительно и достоверно больше, чем у животных двух контрольных групп: получивших только инъекцию MPTP и получивших трансплантацию клеток не содержащих трансгенный mGDNF с последующей инъекцией MPTP (HEK293/GFP+MPTP) .

–  –  –

(SNC и VTA) .

Рисунок. 24. Результаты подсчета TH+ нейронов в вентральной части среднего мозга (SNC и VTA) у неоперированных животных (нормальная мышь) (положительный контроль), животных 4й группы, которым вводили только MPTP (MPTP) (отрицательный контроль), животных 1й группы, которым вводили клетки HEK293/mGDNF/GFP в стриатум за 3 дня до инъекции MPTP (mGDNF+ MPTP) и животных 2й группы, которым вводили клетки HEK293/GFP перед инъекцией MPTP (HEK+MPTP). Различия между всеми группами животных достоверны по one way ANOVA p 0.05 Далее был проведен иммуногистохимический анализ зоны трансплантации клеток для контроля локализации места введения клеток HEK293/GFP в зоне каудатум-путамен мозга мышей через 17-19 дней (срезы мозга мышей, проходящие через стриатум). Анализ срезов показал повторяемость введения в среднюю часть каудатум- путамена (рисунок 25). Наличие трансгенных клеток определялось по флуореценции GFP. Первые результаты показали, что, несмотря на повторяемость локализации трансгенных клеток в средней части каудатум-путамен, тем не менее, количество трансгенных клеток было ничтожно мало (рисунок 25). Данный результат можно объяснить длительным сроком, прошедшим между моментом введения клеток и анализом срезов (17-19 дней) .

Рисунок. 25. Клетки экспрессирующие маркерный белок GFP почти отсутствовали в месте введения в каудатум-путамене животных через 17-19 дней после введения трансфицированных клеток. Фотография в свете флуоресценции среза мозга подопытного животного с треком введения (отмечен стрелкой) трансгенных клеток с mGDNF. Масштаб

– 1 мм .

Поэтому в дальнейших экспериментах для исследований активности воздействия GDNF срок между введением и анализом был уменьшен до 3 дней. Таким образом, в следуещей партии животные, которым были трансплантированы клетки HEK293/mGDNF/GFP и HEK293/GFP были перфузированы через 3 дня после трансплантации. В этих экспериментах было показано наличие значительного количества трансгенных клеток, содержащих маркерный GFP в зоне трансплантации. Срезы, содержащие зону трансплантации подвергали иммуногистохимическому окрашиванию с помощью антител против GDNF (Santa-Cruz, США). Для этого после троекратной промывки в PBS срезы толщиной 40 микрометров погружали в раствор первичных антител против GDNF в разведении 1:100 на 12 часов при 4оС. Затем использовали вторичные антитела фирмы Jackson Immunoresearch конъюгированые c флуоресцентным красителем Texas Red. Иммногистохимический анализ с помощью антител против GDNF показал, что клетки HEK293/mGDNF/GFP через 3 дня после трансплантации в стриатум продолжают экспрессировать трансгенный mGDNF (рисунок 26) .

Рисунок 26. Результат иммуногистохимического окрашивания места введения на mGDNF. Место введения трансгенных клеток продуцирующих mGDNF/GFP. А – флуоресценция GFP (зеленое свечение) в месте введения. Б – фоновая окраска бисбензимидом (ядра клеток). В – флуоресценция клеток содержащих иммуногистохимически выявленный GDNF .

Исследование показало, значимое повышение количества тирозингидроксилазапозитивных нейронов в компактной части черной субстанции у животных, в каудатумпутамен которых были инъецированы клетки трансгенные по mGDNF. Было отмечено, что количество тирозингидроксилаза-позитивных нейронов было в более чем в два раза выше при использовании клеток с mGDNF по сравнению с контрольной группой, которой вводили только МРТР без воздействия клеток. В то же время количество тирозингидроклилаза-позитивных клеток при использовании клеток с mGDNF было достоверно выше, нежели при использовании клеток без mGDNF (более чем в 1,5 раза) .

Таким образом, можно утверждать, что введение mGDNF, останавливает гибель нейронов и улучшает восстановительные процессы в зоне повреждения. Таким образом, мы можем утверждать, что mGDNF экспрессируется в клетке, секретируется из нее в среду культивации и обладает активными свойствами стимулировть нейральную дифференцировку прогениторных клеток и поддерживать жизнеспособность клеток при воздействии нейротоксина. Подобные свойства mGDNF могут быть крайне полезны с практической точки зрения. Итак, mGDNF может стать эффективным стимулятором и поддерживающим фактором при нейродегенеративных заболеваниях и других нарушениях, связанных с гибелью нейронов (травма, ишемический инсульт и др.) .

Однако следует помнить, что любая гиперэкспрессия достаточно опасна для организма. Так, например, в работе Fredrik H. Sterky в 2013 году (Sterky FH, et al., 2013) было показано, что избыточная доставка GDNF в стриатум мыши стимулировал негативные последствия, а именно вызывал снижение концентрации дофанэргических нейронов. Данный результат подчеркивает важность тщательного контроля концентрации введенного фактора в организме, и особенно это относится к трансгенным клеткам, продуцирующим терапевтический фактор .

3.2. Изучение фактора GDNF под контролем регулируемого промотора hsp70 Drosophila melanogaster Исследованиям такого контролируемого продуцирования фактора и посвящена вторая часть диссертации .

Необходимо было изучить возможность «включать» и «выключать» синтез GDNF в трансплантированных клетках. Это достаточно легко удается сделать в культуральных условиях, но гораздо сложнее in vivo. В нашей работе выбрана наиболее «мягкая» система регуляции трансгена с помощью температурозависимого промотора гена белка теплового шока Drosophila. Данный этап работы представляет собой подбор системы регуляции трансгена. Система, характеризуется свойствами промотора hsp70 Drosophila melanogaster, такими как: реагировать на температуру выше 28-300С и активировать при этом сцепленный с ним ген. Корочкиным Л.И. было выдвинуто предположение, что такая система может быть очень удобна для использования в клеточной терапии, так как температура тела млекопитающих и человека является автоматическим стимулятором промотора белка теплового шока дрозофилы (Корочкин, 2000). Однако в дальнейшем было показано, что промотор hsp70 Drosophila melanogaster в организме млекопитающих активируется при более низкой температуре. И встал вопрос изучения тонкой регуляции активации данного промотора в клетках млекопитающих .

Были синтезированы два вектора, которые имеют две разные области регуляции промотора. Один из векторов включает в своем составе +100 пар нуклеотидов перед промотором (В7), а другой +500 (F7), соответственно. (Рисунок 27). Данные вектора отличаются лишь количеством элементов теплового шока HSE, необходимых для активации данного промотора. Данные вектора, содержат ген флуоресцентного белка GFP, который будет выступать в качестве маркера, а также ген неомицина, что позволит производить селекцию трансфецированных клеток на G418 .

Рисунок 27. Схема расположения элементов теплового шока (HSE) в регуляторной области полученных векторов В7 (a) и F7 (b) .

–  –  –

Gtcgacggatccccgacaccagaccaactggtaatggtagcgaccggcgctcagctggaattaggccttctagaccgcggccgcagatc tgttaacgaattcccaattccCTATTCAGAGTTCTCTTCTTGTATTCAATAATTACTTCTTGGCAGA

TTTCAGTAGTTGCAGTTGATTTACTTGGTTGCTGGTTACTTTTAATTGATTCACTTTA

ACTTGCACTTTACTGCAGATTGTTTAGCTTGTTCAGCTGCGCTTGTTTATTTGCTTAG

CTTTCGCTTAGCGACGTGTTCACTTTGCTTGTTTGAATTGAATTGTCGCTCCGTAGAC

GAAGCGCTCTATTTATACTCCGGCGCTCTTTTCGCGAACATTCGAGGCGCGCTCTCTC

GAACCAACGAGAGCAGTATGCCGTTTACTGTGTGACAGAGTGAGAGAGCATTAGTG

CAGAGAGGGAGACCCAAAAAGAAAAGAGAGAATAACGAATAACGGCCAGAGAAAT

TTCTCGAGTTTTCTTCTGCCAAACAAATGACCTACCACAATAACCAGTTTGTTTTGGG

ATTCTAgggggatcggggatcaattctagtatgtatgtaagttaataaaacccttttttggagaatgtagatttaaaaaaacatatttttttttt attttttactgcactggatatcattgaacttatctgatcagttttaaatttacttcgatccaagggtatttgaagtaccaggttctttcgattacctctca ctcaaaatgacattccactcaaagtcagcgctgtttgcctccttctctgtccacagaaatatcgccgtctctttcgccgctgcgtccgctatctctt tcgccaccgtttgtagcgttacctagcgtcaatgtccgccttcagttgcactttgtcagcggtttcgtgacgaagctccaagcggtttacgccat caattaaacacaaagtgctgtgccaaaactcctctcgcttcttatttttgtttgttttttgagtgattggggtggtgattggttttgggtgggtaagca ggggaaagtgtgaaaaatcccggcaatgggccaagaggatcaggagctattaattcgcg Рисунок 28. Последовательность встроенного фрагмента hsp70+500 нуклеотидов в pGemT Easy. Заглавными буквами выделена последовательность промотора hsp70 (453 нуклеотида). Синим отмечена область регуляции 100 нуклеотидов, которая входит в зону регуляции 500 нуклеотидов. Сиквенс был сделан с обратным праймером: phsR (5’taacgaattcccaattccctattcag 3’) .

Данные фрагменты были переклонированы в вектор pEGFP-N1, по сайтам рестрикции HindIII-EcoRI. Наличие вставки в данных конструкциях были проверены с помощью рестрикционого анализа, с последующим секвенированием полученных конструкций (рисунок 29) .

Рисунок 29. Схема генно-инженерных конструкций, содержащих в себе ген зеленого флуоресцентного белка под контролем гена промотора белка теплового шока hsp70 с разной областью регуляции трансгена А. +100 нуклеотидов (В7) Б. +500 нуклеотидов (F7) .

После выделения и очистки эти конструкции были трансфецированы в клетки НЕК293 с использованием реагента ExGene 500 .

При анализе тотальной ДНК трансгенных клеток методом ПЦР было подтверждено наличие гена GFP в геноме трансгенных клеточных линий HEK293. Для метода ПЦР использованием праймеров. Также наличие GFP белка было подтверждено Вестернблоттингом. Из трансгенной клеточной культуры, подвергшейся температурному воздествию, был выделен белок в SDS буфере, данные белки были разогнаны в 10% акриламидном геле и проанализированы с помощью Вестерн-блот гибридизации .

Использовались поликлональные антитела: anti-GFP и вторичные антитела anti-Rabbit, конъюгированные с пероксидазой хрена. Детекция белков осуществлялась при помощи реагента ECL на пероксидазу. Доказано, наличие конструкта в клетках (рисунок 30) .

Рисунок 30. Вестерн-блот гибридизация тотального белка трансгенных НЕК293 с антителами GFP (Rabbit/ polyclonal (ab 290)). 1- HEK293 с EGFP-N1 (положительный контроль 420С) 2-3 - HEK293/В7 (2-400С; 3- 410С), 4-6- HEK293/F7 (4-400С; 5- 410С, 6С); 7- HEK293 (контроль) .

Для культивирования НЕК293 использовалась стандартная среда ДМЕМ инкубация проводилась при 370С в СО2 инкубаторе. Культуры клеток после трансфекции исследуемыми векторами и селекции на гиницитине (G418), в течение 10 дней были рассеяны на культуральные чашки. После 24 часов культивирования анализировали воздействие температуры на культуру клеток. Клетки прогревали в инкубаторе при температурах в диапазоне от 370до 42 0С в течение 60 минут. Экспрессию маркерного белка GFP наблюдали с помощью флуоресцентного микроскопа Olympus. (Рисунок 32) .

Было замечено, что в клетках, которые содержат вектор F7 (8 HSE + hsp70), свечение белка GFP было более интенсивное и продолжительное (рисунок 31) .

Рисунок 31. Линия клеток НЕК 293 после трансфекции векторами B7 и F7. a,bМикрофотографии культуры клеток, после трансфекции вектора В7 и температурного воздействия 420 С, a– в фазовом контрасте, b – в свете флуоресценции (объектив 10x).c,d– Микрофотографии культуры клеток, после трансфекции вектора F7 и температурного воздействия 420 С, c – в фазовом контрасте, b – Фотография в свете флуоресценции (объектив х10) .

Было обнаружено, что максимальная экспрессия белка GFP наблюдалась при 420С уже спустя 24 часа после прогрева при использовании вектора с 8 последовательностями HSE перед промотором hsp70. Однако следует отметить, что значительная интенсивность свечения наблюдалась и при повышении температуры воздействия до 400С при использовании трансгенной культуры НЕК293 с вектором имеющим 8 HSE областей регуляции. Часть исследуемых клеток, после воздействия температуры, были зафиксированы в 4% растворе параформальдегида и использовались для измерения интенсивности свечения при помощи метода проточной цитофлуориметрии на приборе FACScan (рисунок 32). Данные приведены для температур 40 и 420С с различным интервалом (24 и 48 часов) после температурного воздействия .

Рисунок 32. Данные проточной цитометрии на культурах клеток HEK293/B7/GFP и HEK293/F7/GFP через 24 ч и 48 ч после воздействия теплового шока (400C и 420C). Доля GFP-положительных клеток в образце HEK293/F7/GFP через 24 и 48 ч после теплового шока была значительно выше, чем в контрольной при 370 C (p 0.05). Звездочка указывает на существенное различие между HEK293/B7/GFP и HEK293/F7/GFP клеток (р 0.05) .

Культуры, не подвергающиеся воздействию теплового шока (370C), были использованы в качестве контроля. Доля GFP-позитивных клеток через 24 и 48 часов после теплового шока при 40 и 420 C значительно (p0.05) отличались от контроля (370 C) .

Данные представляют среднее - SD от трех независимых экспериментов. Значительное увеличение доли GFP-положительных клеток в культуре HEK293/B7/GFP наблюдалась только через 48 ч после теплового шока (p 0.05), как представлено на рисунке 33. B то время, как клетки HEK293/F7/GFP активно флуоресцировали уже и через 24 часа как после воздействия температуры в 400C, так и в 420C. Обнаруженный эффект потребовал провести эксперимент с более точной шкалой температурного воздействия. Таким образом, была проанализирована эффективность воздействия на активацию промотора следующих температур: 370C, 380C, 390C, 400C, 410C, 420C .

Было показано, что активация промотора, как при наличии 4 HSE зон, так и при наличии 8 HSE зон наблюдается уже при 380С. Однако интенсивность флуоресценции заметно выше при использовании F7. Было замечено, что при использовании 4-ех HSE перед промотором hsp70 активация промотора в клетках наблюдается при 400С с незначительной интенсивностью (около 10%). При этом падение интенсивности свечения через 48 часов после воздействия было незначительным с 10% до 3%. При воздействии температуры в 420С на трансгенную культуру с В7 обнаруживалось свечение клеток 8,2 %, которое значительно увеличивалось к 48 часам культивирования после температурного воздействия до 23,4%. Таким образом, 4-ех HSE практически «подчиняют» промотор hsp70 Drosophila melanogaster «законам» клеток млекопитающих .

Значительно большую интенсивность мы наблюдали после температурного воздействия на трансгенные клетки, содержащие вектор F7 с 8 последовательностями HSE перед промотором. Увеличение количества HSE зон перед промотором увеличивало интенсивность флуоресценции GFP при температуре в 380С до 15% и эта интенсивность не падала через 48 часов. При температуре в 400С флуоресценция резко увеличивалась до 23,2% и незначительно изменялась через 48 часов (22,1%). Процент светящихся клеток при воздействии температуры в 420С тоже значительно увеличивался и достигал 49,9% через 24 часа и незначительно падал до 47,4% через 48 часов после воздействия (рисунок 33). Таким образом, увеличение количества HSE областей перед промотором hsp70 значительно усиливает его активность и интенсивность ответа на температурное воздействие .

После 72 часов наблюдается уменьшение синтеза белка GFР. Однако при повторном нагревании, наблюдается вторичное активация синтеза белка .

Рисунок 33. Температурная зависимость активации промотора дрозофилы hsp70 в клетках HEK293 с B7/GFP и F7/GFP через 24 часа(А) и через 48 часов(В) после воздействия .

Данные получены методом проточной цитометрии. Ось ординат: доля GFP-позитивных клеток через 24 ч (а) и 48 ч (б) после теплового шока .

Данная система активации температурно-зависимого промотора работает в культуре клеток НЕК293. Установлено, что оптимальное время действия температурной активации составляет 60 минут, а максимальное свечение зеленого флуоресцентного белка GFP наблюдается с 24 часа до 48 часов после воздействия температуры. Был выявлен эффект повторного включения промотора и возникновения свечения зеленого флуоресцентного белка после повторного воздействия температуры .

На основании данных векторов и для регулирования трансгена нами были созданы генно-инженерные конструкции, содержащие ген нейротрофического фактора GDNF под контролем промотора гена белка теплового шока дрозофилы hsp70 .

Для клонирования были использованы полученные вектора, которые были описаны выше и ген нейротрофического фактора GDNF. Экспериментальным методом была подобрана замена в pre-области, позволяющая добиваться флуоресценции GFP. Рreобласть содержала дополнительный нуклеотид G, в N’ -концевой сигнальной последовательности. Было показано, что рамка считывания, начинающаяся с ATG сигнальной последовательности GDNF, терминируется, тогда как дополнительный ATG в pre-области позволяет получать неизмененную последовательность mGDNF. Таким образом, в белке вместо последовательности MKLWDVVAVCLVLLHTASA (19аа), кодирующей сигнальный пептид, нами была введена последовательность MSWLSAWCCSTPRPP (15аа). Структура зрелого GDNF нарушена не была. Полученная конструкция с GDNF, содержащая вышеописанную замену, была проанализирована в культуре эмбриональной почки человека HEK293. Далее для клонирования были использованы следующие праймеры: Т3 (5’-attaaccctcactaaaggga- 3’) и GDNF-BamHI (5’tggatcccagatacatccacaccttttagcgg - 3’). Фрагмент был встроен в вектор pGEM-T Easy .

Наличие вставки в конструкции pGEM-T/GDNF было проверено с помощью метода рестрикции по сайту EcoRI, а также методом ПЦР и секвенированием .

Из данной конструкции был вырезан ген нейротрофического фактора GDNF по сайтам рестрикции EcoRV-BamHI (600bp) и встроен в вектора B7 и F7 по сайтам рестрикции SmaI/ BamHI. Наличие вставки в данных конструкциях было проверено с помощью рестриктного анализа по различным сайтам, в том числе по сайтам клонирования методом ПЦР с праймерами GDNF-F (5’-ggaatcggcaggctgcagctg-3’) и GFP R (5’-aataaagcttgcatggcggtaatacg - 3’) (рисунок 34) .

Рисунок 34. Фотография гель-электрофореза ПЦР реакции плазмидной ДНК с праймерами GDNF(F) и GFP (R). 1,2- ДНК вектора B7 и F7 соответственно; 3- ДНК плазмиды В7/GDNF 4-ДНК плазмиды F7/GDNF .

Так же было проведено секвенирование с помощью праймеров GDNF (F) (5’ggaatcggcaggctgcagctg- 3’) и GDNF (R) (5’-aatgctttcttagaatatggt - 3’). Схемы геннноинженерных конструкций представлены на рисунке 35 .

Рисунок 35. Схема генно-инженерных конструкций, содержащих в себе химерный GDNF/GFP под контролем промотора hsp70 Drosophila melanogaster с 4 и 8 HSE А. +100 нуклеотидов (4 HSE) (В7/GDNF/GFP) В. +500 нуклеотидов (8 HSE) (F7/GDNF/GFP) .

После выделения и очистки конструкции В7/GDNF/GFP и F7/GDNF/GFP были трансфецированы в культуры клеток НЕК293 с использованием реагента ExGene 500 .

После 24 часов культивирования трансгенные клетки прогревали при нескольких значениях температуры от 370до 42 0С в течение 60 минут. Экспрессию белка GFP наблюдали с помощью флуоресцентного микроскопа Olympus (рисунок 36) .

Рисунок 36. Трансгенные клетки НЕК 293 с В7/GDNF/GFP (А и В) и F7/GDNF/GFP (C и D). A, B-Микрофотографии культуры клеток, после трансфекции В7/GDNF/GFP и температурного воздействия 400 С, А – в фазовом контрасте, B – в свете флуоресценции (объектив 10x). C, D – Микрофотографии культуры клеток, после трансфекции F7/GDNF/GFP и температурного воздействия 400 С, C – в фазовом контрасте, D – Фотография в свете флуоресценции (объектив х10) .

Было обнаружено, что экспрессия белка GFP наблюдалась при 400С уже спустя 24 часа после прогрева. Часть исследуемых клеток, после воздействия температуры, были зафиксированы в 4% растворе параформальдегида и использовались для измерения интенсивности свечения при помощи метода проточной цитофлуориметрии на приборе FACScan (рисунок 37). Результаты цитофлуориметрии подтвердили, что свечение химерного белка GDNF/GFP наблюдается уже через 24 часа после воздействии температуры в 400С. Доля GFP-положительных клеток в образце HEK293/F7 GDNF/GFP через 24 после теплового шока была выше (p0.05). Однако следует отметить, что количество HSE зон меньше влияет на активизацию флуоресценции GDNF/GFP: при 4 HSE – 30.3% светящихся клеток, при 8 HSE – 43% светящихся клеток. Обнаружено, что при возрастании времени анализа флуоресценции до 48 часов после воздействия процент светящихся клеток значительно увеличивался. Интересен тот факт, что при этом динамика нарастания процента флуоресцирующих клеток была значительно выше при использовании конструкции В7/GDNF/GFP (содержащей 4HSE): с 30,3% до 82,2%. При этом температура в 420С оказалась несколько менее эффективной для стимуляции экспрессии GDNF/GFP как при использовании 4HSE, так и при 8HSE. Однако, при применении конструкции с содержанием 8 HSE в предпромоторной области разница нивелировалась через 48 часов (при 400С через 48 часов – 51%, при 420С через 48 часов – 53%) (рисунок 37) .

Рисунок 37. Графики проточной цитофлуоремитрии после теплового шока на культуры клеток HEK293/B7/GDNF/GFP и HEK293/F7/GDNF/GFP. Флуоресценция трансгенных клеток HEK293/B7/GDNF/GFP и HEK293/F7/GDNF/GFP спустя 24 ч и 48 ч после теплового шока при температурах 400 C и 420 C .

Так же культуры, не подверженные воздействию теплового шока, были использованы в качестве контроля (370 C). Доля GFP-позитивных клеток через 24 и 48 часов после теплового шока при 40 и 420 C значительно (p0.05) отличались от контроля (370 C). Данные представляют среднее - SD от трех независимых экспериментов .

–  –  –

Рисунок 38. Графическое отображение изменения флуоресценции изучаемых образцов культуры клеток НЕК293/В7/GDNF и НЕК293/F7/GDNF после температурного воздействия (хит-шок). А- Анализ экспрессии через 24 часа после хит-шока. Б-Анализ экспрессии через 48 часов после хит-шока .

После 72 часов наблюдается уменьшение экспрессии белка GFР. Однако при повторном нагревании, наблюдается вторичное включение экспрессии белка. Для подтверждения был проведен ПЦР-анализ на наличие химерной последовательности GDNF/GFP.Из трансгенных культур была выделена PHK и синтезирована кДНК с помощью обратной ревертазы .

Для исследования анализа эффективности активизации GDNF под контролем промотора hsp70 Drosophila были выполнены две серии экспериментов. В первой серии экспериментов клетки НЕК293 трансфицированные с помощью конструкций В7/GDNF/GFP и F7/GDNF/GFP с регулируемым промотором hsp70 Drosophila нагревали в течение 60 минут при 420 C, и трансплантированы в стриатум мыши. Спустя 1, 3, 5 и 10 дней на срезах мозга в зоне трансплантации клеток с помощью флуоресцентного микроскопа были обнаружены клетки содержащие GFP (Рисунок 39). Количество GFP содержащих клеток было максимально спустя 24 часа после инъекции и уменьшалось со временем. При исследовании срезов мозга мышей через 10 дней после трансплантации флуоресцирующих клеток на срезах стриатума подопытных мышей найдено не было .

Существенных различий в количестве и интенсивности флуоресценции между клетками содержащими конструкции векторов В7/GDNF/GFP и F7/GDNF/GFP найдено не было .

Рисунок 39. Клетки линии НEK293 трансфицированные конструкцией F7/GDNF/GFP через 24 часа (А), через 3 дня (Б) и через 5 (С) дней после нагревания до 42оС и введения в хвостатое ядро-скорлупу мозга мыши. Фронтальный срез мозга мыши (20 микрометров) через место введения. Масштаб - 0,5 мм, Во второй серии экспериментов использовалась мышиная модель ишемического инсульта. Были проведены эксперименты по введению трансгенных клеток HEK293/В7/GDNF/GFP и HEK293/F7/GDNF/GFP в мозг мышей с экспериментальной фокальной церебральной ишемией, полученной с помощью методики c применением вазоконстриктора эндотелина 1. Сразу после введения эндотелина 1 в то же отверстие и на ту же глубину инъецировали суспензию примерно 200000 клеток в 1 микролитре раствора Хенкса. В этих экспериментах клетки перед введением в мозг не подвергали нагреванию, ожидалась активация промотора воспалительным процессом при транспалантации .

Эксперименты показали, что через 24 часа после инъекции большое количество клеток располагалось в зоне инъекции. Спустя 3 дня после инъекции, как и в первой серии экспериментов, в зоне введения клеток были найдены лишь единичные клетки, содержащие GFP. Значительно большее количество GFP содержащих клеток было найдено вне зоны инъекции. В большинстве случаев клетки располагались у сосудов, или вблизи белого вещества больших полушарий (Рисунок 40). Небольшое количество флуоресцирующих клеток располагалось в первом слое коры. Спустя 5 суток после инъекции клеток лишь незначительное количество клеток, содержащих GFP, было найдено на срезах мозга в зоне введения. На срезах мозга контрольных животных, которым вводили трансфицированные клетки без предварительного введения эндотелина, были найдены лишь единичные клетки (по 1-2 на срез) в месте введения .

Рисунок 40. Экспрессия трансгенного GFP в клетках HEK293/F7/GDNF/GFP в мозге мыши через 3 дня введения вокруг тромбированного сосуда (в рамке на рисунке А и увеличено на рисунке Б) после введения клеток в месте введения клеток и эндотелина 1 (отмечено стрелкой) и в стороне от места Следует отметить, что при анализе трансплантаций контрольных клеток НЕК293/GFP не наблюдалась миграция клеток из зоны трансплантации в паренхиму мозга .

ОБСУЖДЕНИЕ

Обнаружение, свойств GDNF, как стимулятора образования аксонов у нервных предшественников in vivo позволили предположить, что, найден фактор, способный решать проблемы нейродегенерации и противодействовать гибели нейронов в результате ишемического инсульта или нейродегенеративных заболеваний. Однако, в результате клинических исследований рекомбинантного GDNF при интрацеребровентрикулярном введении пациентам с болезнью Паркинсона было показано, что клинические улучшения были незначительны или отсутствовали. При введении рекомбинантного GDNF в полосатое тело с помощью минипомпы, значимый эффект изначально наблюдался (Gill et al. 2003), однако, потом не был подтвержден на двойной слепой фазе II клинических испытаний, которые проводила компания Amgen. В результате компания отказалась от дальнейших клинических исследованиий. Тем не менее, принимая во внимание хорошо известные протективные свойства GDNF, научное и бизнес сообщества не прекращают попыток найти методику применения этого фактора в лечении нейродегенеративных заболеваний. Так компании MedGenesis Therapeutix и Pfizer заключили соглашение по совместной разработке методов применения GDNF и метода convection enhanced delivery для лечения болезни Паркинсона .

Мы обратили внимание на тот факт, что белок GDNF обладает широким спектром полифункциональных свойств. Он способствует интенсификации роста аксонов, и увеличению количества дофаминэргических нейронов (Lin et al. 1993). Кроме того GDNF является потенциальным фактором для выживания и регенерации дофаминэргических нейронов черной субстанции. (Airaksinen, et al. 2002; Andressoo, et al. 2008,.). GDNF обеспечивает развитие и выживание моторных и сенсорных нейронов, нейронов энтеральной парасимпатической и симпатической нервных систем (Lin et al., 1993;

Andressoo et al. 2008). Столь внушительный список функций, позволяет сделать предположение, что возможны различные формы GDNF обладающие специфическими функциями в различных процессах. Возможно, активность данного нейротрофического фактора связана и с интенсивностью секреции GDNF из клеток. Так для поддержания жизнеспособности и нормального функционирования нейрональных клеток в здоровом мозге достаточно конститутивной секреции GDNF с низкой интенсивностью. Тогда как противодействие нейродегенеративным процессам, например гибели дофаминэргических нейронов при болезни Паркинсона, может потребовать повышенной концентрации GDNF .

с соавторами обнаружили, что размер влияет на Lonka-Nevalaita pro-области преимущественный путь транспортировки фактора из клетки. Так сплайс вариант GDNF с «длинной» pro-областью в 58 а. к. (174 п.н.) секретируется конститутивным путем, проходя через аппарат Гольджи с последующим везикулярным транспортом к клеточной мембране. Сплайс вариант с короткой pro-областью в 32 а.к. (96 п.н.) делетированной proобластью в 96 п.н. секретируется по «быстрому» пути, минуя аппарат Гольжди, через секретогранин II и Rab3A позитивные секреторные везикулы. Одной из задач моей работы было исследовать, влияние наличия prе- и pro- областей на свойства GDNF, как нейротрофического фактора. На основании полученных результатов, можно сделать несколько предположений. При получении модификаций GDNF/GFP, у которых удалены либо pro-область, либо prе-область, либо обе эти области, не обнаруживалось нарушений секреции фактора из трансфицированных клеток в среду. Однако, при исследовании клеток с prе-pro- GDNF/GFP обнаруживалось нарушение флуоресцентного свечения GFP, а вестерн-блотинг показал отсутствие экспрессии GFP. Также было обнаружено, что нейротрофический фактор с удаленной prе-областью (pro- GDNF/GFP) секретируясь в среду, тем не менее не являлся индуктором нейральной дифференцировки. Мы не наблюдали ни в одном из экспериментов образование даже небольших нейрональных отростков у эмбриональных спинальных ганглиев. Возможно удаление prе-области нарушает активность изучаемого белка. При сохранении сигнальной последовательности и удалении pro-области фактор секретировался в среду и обладал несколько сниженными трофическими свойствами, соизмеримыми, однако, со свойствами полноразмерного recGDNF. Вероятно, удаление pro-области, не влияет на индуктивные способности фактора, но при этом значительно снижает активную секрецию фактора из клеток .

Отсутствие нарушений секреции делетированной модификации GDNF может объясняться особенностями транспорта GFP. Так в работе M. Tanudji (Tanudji et al., 2002) доказано, что GFP транспортируется неклассическим способом. Вероятно, в нашем случае GFP берет на себя функцию транспортера в процессе секреции mGDNF/GFP. Интересно, что делетирование pro- и pre- областей ни в коей степени не снижало индуктивные свойства GDNF, а напротив заметно их улучшало .

Для проверки нейропротективных свойств конструкции с mGDNF в ситуации in vivo мы проводили эксперименты на модели болезни Паркинсона на мышах, полученной с помощью инъекции пронейротоксина MPTP - (МФТП, англ. сокр. MPTP: 1-метил-4фенил-1,2,3,7-тетрагидропиридин) .

Инъекция MPTP приводила к значительному снижению числа ТН+ нейронов с вентральной части среднего мозга подопытных животных. Трансплантация трансгенных клеток с геном GDNF без сигнальных последовательностей в каудатум-путамен мышей за 3 дня перед инъекцией MPTP в значительной степени нивелирует негативное воздействие пронейротоксина. В этих условиях действие MPTP сводится к значительно меньшему снижению численности ТН+ нейронов, чем у животных без введения клеток, и у животных с предварительным введением клеток, не экспрессирующих mGDNF/GFP .

Следует отметить, что имплантация клеток линии HEK293, не содержащих mGDNF/GFP, предшествующая введению нейротоксина МФТП, все же оказывает нейропротекторное воздействие на ДА-эргические нейроны компактной чёрной субстанции и вентральнотегментальной области, что выражается в достоверном превышении подсчитанного числа дофаминэргических нейронов по сравнению с животными без введения клеток. Подобный эффект протективного влияния нетрансфицированных клеток был описан в работе Cunningham и Su (2002). Можно вслед за авторами этой работы предположить, что этот эффект обусловлен слабым трофическим воздействием инъецированных клеток или воздействием факторов, выделяемых клетками мозга при повреждении в результате инъекции значительного объема клеточного материала .

Стандартным методом оценки функциональных нарушений при этой модели является тест удерживания на вращающемся барабане - Rota-rod test. Исследования этим методом показали, что введение клеток трансфицированных mGDNF/GFP без сигнальных pre- и pro- последовательностей значительно и достоверно ослабляет воздействие МРТР на моторные способности подопытных животных. Небольшое ослабление действия МРТР наблюдали и после введения в стриатум клеток без mGDNF/GFP, но этот результат не отличался достоверно от контроля с инъекцией МРТР без введения клеток .

Однако понятно, что увеличение интенсивности воздействия mGDNF на клетки организма требует регуляции данной активности. Любое постоянное и активное воздействие трансгенного фактора будет негативно сказываться на функциях клеток. В рамках данной проблемы мы исследовали возможность использования промотора hsp70 Dr.melanogaster в качестве регуляторного элемента для управляемой экспрессии трансгенного фактора. Ранее было показано, что промотор hsp70 Dr.melanogaster при введении в клетки млекопитающих может функционировать как температурозависимый промотор (Corces, 1984; Corces, V., 1981, Павлова и др., 2005; Андреева и др. 2006). В этой работе Corces с соавторами было показано, что для активации промотора в клетках млекопитающих необходимо нагревание до температуры 450C. В работе Schweinfest было показано, что при получении трансгенных линий клеток млекопитающих, в которых экспрессируется с-mус под контролем промотора hsp70 Dr.melanogaster активация промотора, а следовательно и экспрессия трансгена, происходит при 420С (Schweinfest, 1988). В нашей опубликованной работе (Павлова Г.В., 2005) было показано, что возможно регулировать температуру активации промотора hsp70. Следовательно, существуют механизмы, используя которые, возможно снизить температурный порог активации промотора hsp70 Dr.melanogaster в клетках млекопитающих. В работе Андреевой (Андреева 2006) было показано, что активность промотора hsp70 дрозофилы не в полной степени совпадает с температурой хитшока организмов в клетки, которых он внедрен .

Так, например, при введении конструкции, содержащей промотор hsp70 Dr.melanogaster в ткани эмбриона вьюна активация данного промотора вовсе не зависит от температуры и трансгенный Gfp, находящийся под контролем этого промотора экспрессируется с постоянной интенсивностью при разных температурах среды. Таким образом, температурная регуляция промотора hsp70 дрозофилы зависит от регулирующих белков клетки, в которой происходит его активация. Количество HSE областей, находящихся на 5’конце промотора теплового шока дрозофилы регулируют температурную чувствительность промотора, а также продолжительность активации hsp70. В нашей работе количества встроенных HSE 4 и 8 выбраны в связи с тем, что промоторные области hsp70 D.virilis и D.lummei имеют по две последовательности HSE, тогда как в составе промотора D.melanogaster обнаружены четыре копии HSE (Amin et al 1988; Xiao, Lis, 1988; 1989). При этом у человека находят от 1 до 3 HSE зон перед последовательностью хит-шокового промотора (Wilkerson, 2007). В статье Wilkerson утверждается, что обычно у человека наблюдается 2 HSE последовательности перед промотором со ссылкой на работы Wu и Abravaya (Wu et al., 1986; Abravaya et al., 1991). Кроме того, утверждается, что увеличение количества HSE зон до трех улучшает активный ответ промотора на повышение температуры. Опираясь на предварительные исследования, мы предположили, что при увеличении количества HSE областей перед промотором можно регулировать температуру активации и длительность работы данного промотора. При исследовании векторов В7 и F7, содержащих соответственно 4 и 8 HSE областей в 5’концевой области промотора дрозофилы, было обнаружено, что данные промоторы активируются в клетках млекопитающих (человека) уже при температуре 38 0С, причем увеличение количества HSE последовательностей до 8 значительно улучшает активацию исследуемого промотора. Мы наблюдали при анализе трансгенной культуры через 24 часа после прогревания увеличение флуоресцирующих клеток при 380С с 3% (В7) до 15% (F7), при 390С с 7% (В7) до 20% (F7), достигая к 420С при использовании В7 7%, а при F7 до 59,9%. Кроме того, отличием также является быстрота достижения максимальной активности промотора после воздействия хит-шоковой температуры. При использовании 4 HSE в 5’-концевой области максимальная активность промотора наблюдается через 48 часов и этот максимум в два раза ниже, чем максимум достигаемый hsp70 промотором с 8 HSE, который наблюдается уже через 24 часа и поддерживается в течении 48 часов. В ходе работы установлено, что оптимальная продолжительность нагревания для активации промотора составляет 60 минут, а максимальное свечение GFP наблюдается с 24 часа до 48 часов после воздействия температуры. Был выявлен эффект повторного включения промотора и возникновения свечения GFP после повторного нагревания .

Таким образом, можно утверждать, что увеличение количества HSE областей перед промотором повышает чувствительность промотора к нагреванию. При трансплантации трансгенных клеток НЕК293/В7 и НЕК293/F7 в паренхиму мозга мыши было обнаружено, что промотор активируется и Gfp длительно экспрессируется в зоне локальной ишемии .

Кроме того, трансгенные клетки активно мигруруют в ишемизированную паренхиму мозга вдоль сосудов .

Количество HSE областей, находящихся на 5’конце промотора теплового шока дрозофилы регулируют температурную чувствительность промотора, а также продолжительность активации hsp70. Интересным фактом, является то, что при клонировании функционального гена (в нашем случае мы использовали ген GDNF) разница в температурной активации между промотором hsp70 с четырьмя HSE и промотором hsp70 с восьмью HSE меняется относительно разницы при клонировании маркерного GFP. Мы наблюдали высокую активацию промотора через 24 часа, а также его максимальное значение через 48 часов после воздействия, причем разница между активацией промотора с 4 HSE и промотора с 8 HSE уменьшалась. Таким образом, на активацию промотора теплового шока дрозофилы в клетках млекопитающих влияет не только конфигурация HSE зон, но и природа белка, клонированного под этим промотором .

Опираясь на предварительные исследования, мы предположили, что при увеличении количества HSE областей перед промотором можно регулировать температуру активации и длительность работы данного промотора. При исследовании векторов В7 и F74, содержащих соответственно 4 и 8 HSE областей в 5’-концевой области промотора дрозофилы, было обнаружено, что данные промоторы активируются в клетках млекопитающих (человека) уже при температуре 380С, причем увеличение HSE последовательностей до 8 значительно улучшает активацию исследуемого промотора .

Кроме того, увеличение количества HSE до 8 повышает быстроту достижения максимальной активности промотора после воздействия хит-шоковой температуры. При использовании 4 HSE максимальная активность промотора наблюдается через 48 часов и этот максимум в два раза ниже, чем максимум достигающийся hsp70 промотором с 8 HSE, который наблюдается уже через 24 часа и поддерживается в течении 48 часов. При трансплантации трансгенных клеток НЕК293/В7 и НЕК293/F7 в паренхиму мозга мыши было обнаружено, что промотор активируется и GFP длительно экспрессируется в зоне локальной ишемии. Кроме того, трансгенные клетки активно мигрируют в паренхиму мозга вдоль сосудов. Количество HSE областей, находящихся на 5’конце промотора теплового шока дрозофилы также регулируют температурную чувствительность промотора и продолжительность активации hsp70 in vivo .

Полученные результаты свидетельствуют о том, что поиск и создание новых модификаций генных конструкций, содержащих ген нейротрофического фактора GDNF, может привести к созданию более эффективных геннотерапевтических препаратов .

ЗАКЛЮЧЕНИЕ

Подводя итог описанным выше работам, можно обсудить следующие результаты .

Были проанализированы несколько типов глия-производного нейротрофического фактора GDNF, с различной комбинацией наличия/отсутствия pre- pro- последовательностей. Было показано, что все варианты нейроторофического фактора не только экспрессируются в клетке после введения конструкций методом трансфекции, но также секретируются в окружающую среду, что позволило нам использовать кондиционированную среду, как индуктор нейральной дифференцировки. Подобные свойства были подтверждены при анализе образования отростков у клеток линии РС12 и оценке образования нейральных отростков у эмбриональных спинальных ганглиев крысы. Эксперименты с цельными спинальными ганглиями, а также при использовании культуры рассеяного спинального ганглия крысы показали, что mGDNF/GFP значительно более активно стимулирует нейрональную дифференцировку клеток нежели recGDNF, prо-GDNF/GFP и prеGDNF/GFP. Исследования, проведенные на животных с экспериментальной нейродегенерацией (болезнь Паркинсона), продемонстрировали, что трансплантация клеток линии НЕК293/mGDNF/GFP в стриатум оказывает положительное влияние на восстановительные процессы в мозгу мыши. Так же в ходе работы была подобрана и протестирована модель безопасной активации трансгена с использованием гена промотора hsp70 теплового шока дрозофилы. Данная система продемонстрировала не только эффект активации in vitrо, но также положительную динамику активации в очаге воспаления in vivo. Установлено, что оптимальное время действия температурной активации составляет 60 минут, а максимальное свечение зеленого флуоресцентного белка GFP наблюдается с 24 часа до 48 часов после воздействия температуры. Был выявлен эффект повторного включения промотора и возникновения свечения зеленого флуоресцентного белка после повторного нагревания. В ходе экспериментов было показано, что температурная чувствительность промотора hsp70 Dr.Drosophila в клетках млекопитающих зависит от количества HSE областей, находящихся на 5’конце промотора, а также это количество влияет на продолжительность активации hsp70 .

Интересным фактом, является то, что при клонировании функционального гена (в нашем случае мы использовали ген GDNF) разница в температурной активации между промотором hsp 70 с 4HSE и промотором hsp 70 с 8HSE меняется. Мы наблюдали высокую активацию промотора через 24 часа, а также его максимальное значение через 48 часов после воздействия, причем разница между активацией промотора с 4 HSE и промотора с 8 HSE уменьшалась .

ВЫВОДЫ

1. В экспериментах in vitro на клеточных культурах показано, что делеция pre- и prопоследовательностей гена GDNF (одной из них или одновременно обеих) не нарушает секрецию GDNF из клетки .

2. Показано, что mGDNF/GFP секретируется из клетки в среду как минимум в два раза активнее, чем рre-рro-GDNF/GFP .

3. Показано, что делеция только pre-последовательности GDNF, не нарушая секреции фактора, блокирует его способность стимулировать образование нейральных отростков у эмбриональных спинальных ганглиев крысы .

4. Показано, что делеция prо-последовательности (mGDNF и pre-GDNF) не снижает способности GDNF стимулировать образование нейральных отростков у спинального эмбрионального ганглия крысы. При этом одновременная делеция prе- и prо-последовательностей значительно повышало данные свойства у GDNF .

5. На мышиной модели болезни Паркинсона показано, что имплантация трансгенных клеток НЕК293 продуцирующих mGDNF/GFP редуцировала эффект пронейротоксина MPTP, что проявлялось в двукратном увеличении количества тирозингидроксилаза-позитивных нейронов в среднем мозгу и в улучшении моторной координации подопытных животных по сравнению с контрольными .

6. Показано, что увеличение количества HSE последовательностей с 4 до 8 перед промотором hsp70 Dr.melanogaster значительно усиливает его чувствительность к температурному воздействию в клетках млекопитающих .

7. При трансплантации в мозг мышей с экспериментальной фокальной церебральной ишемией трансгенных клеток НЕК293 с GDNF/GFP под контролем промотора hsp70 Dr.melanogaster (В7 и F7) с 4 или 8 HSE последовательностями в предпромоторной области GDNF/GFP активно синтезировался через 24 часа с постепенным затуханием в течение 5 суток .

СПИСОК ЛИТЕРАТУРЫ

1. Андреева Л.Е., Хайдарова Н.В., Родригес-Бланко А.В., Канайкина Н.Н., Ревищин А.В., Тарантул В.З., Корочкин Л.И., Павлова Г.В. Экспрессия репортерных генов под контролем регуляторных элементов гена теплового шока дрозофилы в трансгенных эмбрионах вьюна Misgurnus fossilis L. //Клеточная трансплантология и тканевая инженерия.- 2006.- Т. 4.-№ 6.-С.39-44 .

2. Назаренко С.А. Нарушение эпигенетической регуляции активности генов и болезни человека // Вестник РАМН. -2001.- Т. 10. -С. 43—48 .

3. Корочкин Л.И. Новые подходы в генетике развития и генотерапии:

ксенотрансплантация эмбриональных, нервных клеток дрозофилы в мозг позвоночных.// Генетика.-2000.- Т.36.- С. 1436-1442 .

4. Павлова Г.В., Мануилова Е.С., Арсеньева Е.А., Гривенников И.А., Муркин Е.В., Канайкина Н.Н., Ревищин А.В., В.Н.Тарантул, Корочкин Л.И. Регуляция экспрессии белка BFP в эмбриональных клетках. Бюлл. Эксперим. Медицины .

2005.- Т. 139. -№ 4. -С. 514-516

5. Adler R, Landa KB, Manthorpe M, Varon S.Cholinergic neuronotrophic factors: intraocular distribution of trophic activity for ciliary neurons.//Science.-1979. Т. 204.- № 4400.-С.1434-6 .

6. Abravaya K, Phillips B, Morimoto RI. Heat shock-induced interactions of heat shock transcription factor and the human hsp70 promoter examined by in vivo footprinting. // Mol Cell Biol.- 1991.-Т. 11.-№ 1.-С. 586–592 .

7. Airaksinen MS, Titievsky A, Saarma M.GDNF family neurotrophic factor signaling: four masters, one servant? //Mol Cell Neurosci.-1999.-Т.13.-№5-С.313-25. Review .

8. Airaksinen MS, Saarma M.The GDNF family: signalling, biological functions and therapeutic value.//Nat Rev Neurosci.-2002.-Т.3.-№ 5. С.383-94 .

9. Alberti L, Borrello MG, Ghizzoni S, Torriti F, Rizzetti MG, Pierotti MA.Grb2 binding to the different isoforms of Ret tyrosine kinase.//Oncogene.-1998.-Т.17.-№9.-С.1079-87 .

10. Alfano I, Vora P, Mummery RS, Mulloy B, Rider CC.The major determinant of the heparin binding of glial cell-line-derived neurotrophic factor is near the N-terminus and is dispensable for receptor binding. //Biochem J.- 2007. – Т. 404.-№1. –С.131-40 .

11. Akerfelt M, Morimoto RI, Sistonen L.Heat shock factors: integrators of cell stress, development and lifespan.//Nat Rev Mol Cell Biol.- 2010.- Т.-11.-№8.- С.545-55 .

12. Akerud P, Canals JM, Snyder EY, Arenas E.Neuroprotection through delivery of glial cell line-derived neurotrophic factor by neural stem cells in a mouse model of Parkinson's disease. //J Neurosci. -2001. -Т. 21.№20.С.8108-18 .

13. Akerud P, Holm PC, Castelo-Branco G, Sousa K, Rodriguez FJ, Arenas E.Persephinoverexpressing neural stem cells regulate the function of nigral dopaminergic neurons and prevent their degeneration in a model of Parkinson's disease.// Mol Cell Neurosci. Т. 21.-№2.-С.205-22 .

14. Albert K, Voutilainen MH, Domanskyi A, Airavaara M. AAV Vector-Mediated Gene Delivery to Substantia Nigra Dopamine Neurons: Implications for Gene Therapy and Disease Models.// Genes (Basel). -2017.- Т.8.-№ 2 .

15. Amin J, Fernandez M, Ananthan J, Lis JT, Voellmy R. Cooperative binding of heat shock transcription factor to the Hsp70 promoter in vivo and in vitro.//J Biol Chem.Т. 269.-№ 7.-С. 4804-11 .

16. Amin J, Ananthan J, Voellmy R. Key features of heat shock regulator elements. //Mol Cell Biol.- 1988.-Т.8.-№9.-С. 3761–3769 .

17. Amoresano A, Incoronato M, Monti G, Pucci P, de Franciscis V, Cerchia L.Direct interactions among Ret, GDNF and GFRalpha1 molecules reveal new insights into the

assembly of a functional three-protein complex.//Cell Signal.- 2005.- Т.17.-№ 6.-С.717Anckar J, Sistonen L.. Regulation of HSF1 function in the heat stress response:

implications in aging and disease. //Annual Review of Biochemistry.- 2011.-Т.80С.1089–1115 .

19. Andressoo, J.O.; Saarma, M., Signalling mechanisms underlying development and maintenance of dopamine neurons. // Current opinion in neurobiology.- 2008.- Т.18.-№ 3.- С. 297-306 .

20. Andreeva LE, Khadarova NV, Sleptsova LA, Rodriges-Blanko EV, Dicheva MA, et al .

The effect of regulatory sequences of alphaS1-casein gene on the expression of the lacZgene in loach Misgurnus fossilis L. transgenic embryos. // Genetika.- 2008.-Т.44.- С .

992–999 .

21. Anders J, Kjar S, Ibez CF.Molecular modeling of the extracellular domain of the RET receptor tyrosine kinase reveals multiple cadherin-like domains and a calciumbinding site.//J Biol Chem.- 2001.- Т. 276.- № 38.- С. 35808-17 .

22. Arenas E, Trupp M, Akerud P, Ibez CF. GDNF prevents degeneration and promotes the phenotype of brain noradrenergic neurons in vivo.// Neuron.- 1995.- Т. 15.-№ 6.С.1465-73 .

23. Asai N, Iwashita T, Matsuyama M, Takahashi M.Mechanism of activation of the ret proto-oncogene by multiple endocrine neoplasia 2A mutations. //Mol Cell Biol. Т.15.- № 3.-С.1613-9 .

24. Asai N, Murakami H, Iwashita T, Takahashi M.A mutation at tyrosine 1062 in MEN2ARet and MEN2B-Ret impairs their transforming activity and association with shc adaptor proteins. //J Biol Chem. -1996.- Т.271.-№ 30.-С. 17644-9 .

25. Asai N, Fukuda T, Wu Z, Enomoto A, Pachnis V, Takahashi M, Costantini F. Targeted mutation of serine 697 in the Ret tyrosine kinase causes migration defect of enteric neural crest cells.// Development.- 2006. Т.-133.-С. 4507-16 .

26. Avantaggiato V, Dathan NA, Grieco M, Fabien N, Lazzaro D, Fusco A, Simeone A, Santoro M. Developmental expression of the RET protooncogene. //Cell Growth Differ.Т.5.-№ 3.-С.305-11 .

27. Baler R, Dahl G, Voellmy R. Activation of human heat shock genes is accompanied by oligomerization, modification, and rapid translocation of heat shock transcription factor HSF1. //Molecular and Cellular Biology.- 1993. –Т.13-С.2486–2496 .

28. Barde YA. What, if anything, is a neurotrophic factor? //Trends Neurosci. -1988.- Т. 11.С.343-6 .

29. Baloh RH, Tansey MG, Golden JP, Creedon DJ, Heuckeroth RO, Keck CL,Zimonjic DB, Popescu NC, Johnson EM, Milbrandt J. TrnR2, a novel receptor that mediates neurturin and GDNF signaling through Ret. //Neuron.- 1997.-Т. 18.-С. 793–802 .

30. Baloh RH, Tansey MG, Lampe PA, Fahrner TJ, Enomoto H, Simburger KS, Leitner ML, Araki T, Johnson EM Jr, Milbrandt J. Artemin, a novel member of the GDNF ligand family, supports peripheral and central neurons and signals through the GFRalpha3-RET receptor complex. //Neuron. -1998.- Т. 21.-№ 6.-С.1291-302 .

31. Barbacid M. The Trk family of neurotrophin receptors.//J Neurobiol. -1994.- Т.11.- С .

1386-403. Review .

32. Baloh RH, Gorodinsky A, Golden JP, Tansey MG, Keck CL, Popescu NC, Johnson EM Jr, Milbrandt J.GFRalpha3 is an orphan member of the GDNF/neurturin/persephin receptor family. // Proc Natl Acad Sci U S A. -1998.- Т.95.-№. 10.-С. 5801-6 .

33. Baudet, C., Mikaels, A., Westphal, H., Johansen, J., Johansen, T.E., Ernfors, P.P., Positive and negative interactions of GDNF, NTN and ART in developing sensory neuron subpopulations, and their collaboration with neurotrophins. //Development.T. 127.- C. 4335–4344 .

34. Beck, K.D., Valverde, J., Alexi, T., Poulsen, K., Moffat, B., Vandlen, R.A., Rosenthal, A., Hefti. Mesencephalic dopaminergic neurons protected by GDNF from axotomyinduced degeneration in the adult brain. Nature.-1995. –T. 373.- C. 339–341

35. Bennett DL, Boucher TJ, Armanini MP, Poulsen KT, Michael GJ, Priestley JV, Phillips HS, McMahon SB, Shelton DL. The glial cell line-derived neurotrophic factor family receptor components are differentially regulated within sensory neurons after nerve injury.//J Neurosci. -2000.- Т.20.-№ 1.- С. 427-37 .

36. Bespalov MM, Saarma M.GDNF family receptor complexes are emerging drug targets.// Trends Pharmacol Sci.- 2007.- Т.28.-№ 2.- С.68-74

37. Bettencourt BR, Feder ME.Rapid concerted evolution via gene conversion at the Drosophila hsp70 genes. // J Mol Evol.- 2002.- Т.54.-№ 5.- С. 569-86 .

38. Bevilacqua A, Fiorenza MT, Mangia F.Developmental activation of an episomic hsp70 gene promoter in two-cell mouse embryos by transcription factor Sp1. // Nucleic Acids Res. -1997.- Т.25.-№ 7.- С.1333-8 .

39 .

Bevilacqua A, Fiorenza MT, Mangia F.A developmentally regulated GAGA box-binding factor and Sp1 are required for transcription of the hsp70.1 gene at the onset of mouse zygotic genome activation. //Development. -2000.-Т.127.-№ 7.-С. 1541-51 .

40. Bjrklund A, Lindvall O.Parkinson disease gene therapy moves toward the clinic. //Nat Med. -2000.- Т.6.-№ 11.-С. 1207-8 .

41. Bjrklund A, Dunnett SB. Dopamine neuron systems in the brain: an update. Trends Neurosci.- 2007.- Т.30.- № 5.- С. 194-202 .

42. Black JL.Genome projects and gene therapy: gateways to next generation biological weapons.//Mil Med.- 2003.- Т.168.-№ 11.-С. 864-71. Review .

43. Boucher TJ, Okuse K, Bennett DL, Munson JB, Wood JN, McMahon SB. Potent analgesic effects of GDNF in neuropathic pain states.// Science. -2000.- Т.290.-№ 5489.С.124-7 .

44. Bontempi B, Whelan KT, Risbrough VB, Lloyd GK, Menzaghi F. Cognitive enhancing properties and tolerability of cholinergic agents in mice: a comparative study of nicotine, donepezil, and SIB-1553A, a subtype-selective ligand for nicotinic acetylcholine receptors. //Neuropsychopharmacology.- 2003.- Т.28.-№ 7.-С.1235-46 .

45. Borrello MG, Mercalli E, Perego C, Degl'Innocenti D, Ghizzoni S, Arighi E, Eroini B, Rizzetti MG, Pierotti MA. Differential interaction of Enigma protein with the two RET isoforms.//Biochem Biophys Res Commun. -.2002.- Т.296.-№ 3.-С. 515-22 .

46. Brantley MA Jr, Jain S, Barr EE, Johnson EM Jr, Milbrandt J.Neurturin-mediated ret activation is required for retinal function. //J Neurosci.- 2008.- Т.28.-№ 16.-С. 4123-35 .

47. BujBello, Adu J, Pin LG, Horton A, Thompson JF, Rosenthal A, ChinchetruM, Buch man VL, Davies AM. Neurturin responsiveness requires a GPI-linked receptor and the Ret receptor tyrosine kinase. //Nature.- 1997.-Т. 387.- С.721–724 .

48. Broadbent NJ, Squire LR, Clark RE. Spatial memory, recognition memory, and the hippocampus. //Proc Natl Acad Sci U S A. -2004.- Т.101.-№ 40.-С.14515-20 .

49. Bu L, Jin Y, Shi Y, Chu R, Ban A, Eiberg H, Andres L, Jiang H, Zheng G, Qian M, Cui B, Xia Y, Liu J, Hu L, Zhao G, Hayden MR, Kong X.Mutant DNA-binding domain of HSF4 is associated with autosomal dominant lamellar and Marner cataract. //Nat Genet. -2002.- Т.31.-№ 3.-С.276-8 .

50. Caibano C, Rodriguez NL, Saez C, Tovar S, Garcia-Lavandeira M, Borrello MG, Vidal A, Costantini F, Japon M, Dieguez C, Alvarez CV.The dependence receptor Ret induces apoptosis in somatotrophs through a Pit-1/p53 pathway, preventing tumor growth .

//EMBO J. -2007. –Т. 26.-№ 8.- С.2015-28 .

51. Clos J, Westwood JT, Becker PB, Wilson S, Lambert K, Wu C. Molecular cloning and expression of a hexameric Drosophila heat shock factor subject to negative regulation.//Cell. -1990.- Т. 63.-№ 5.-С.1085-97 .

52. Cik M, Masure S, Lesage AS, Van Der Linden I, Van Gompel P, Pangalos MN, Gordon RD, Leysen JE.Binding of GDNF and neurturin to human GDNF family receptor alpha 1 and 2. Influence of cRET and cooperative interactions.//J Biol Chem. -2000.- Т.275.-№ 36.-С. 27505-12 .

53. Chao MV, Hempstead BL. p75 and Trk: a two-receptor system. //Trends Neurosci. – 1995.- Т.18.- №7.- С. 321-6 .

54. Choi-Lundberg DL, Bohn MC.Ontogeny and distribution of glial cell line-derived neurotrophic factor (GDNF) mRNA in rat. // Brain Res Dev Brain Res.- 1995.- Т.85.-№ 1.-С. 80-8 .

55. Glazenburg K, Gielkens A, Moormann R. / Effects of replacing the promoter of the immediate early gene with the promoter of Drosophila heat-shock gene HSP70 on the growth and virulence of pseudorabies virus. // Vet Microbiol. -1992 - Т.33.- № (1-4).-С .

35-43 .

56. Corey LL, Weirich CS, Benjamin IJ, Kingston RE. Localized recruitment of a chromatin-remodeling activity by an activator in vivo drives transcriptional elongation .

//Genes & Development.- 2003. - Т.17.-С. 1392–1401 .

57. Corces V, Pellicer A, Axel R, Meselson M. Integration, transcription, and control of a Drosophila heat shock gene in mouse cells. //Proc Natl Acad Sci USA.- 1981.-Т. 78.-№ 11.-С.7038–7042 .

58. Corces V, Pellicer A. Identification of sequences involved in the transcriptional control of a Drosophila heatshock gene. //J Biol Chem.- 1984.-Т. 259.-№ 23.-С.14812–14817 .

59. Coulpier M, Anders J, Ibanez CF. Coordinated activation of autophosphorylation sites in the RET receptor tyrosine kinase: Importance of tyrosine 1062 for GDNF mediated neuronal differentiation and survival. // J Biol Chem.- 2002.-Т. 277.- С. 1991–1999 .

60. Chen Y, Barlev NA, Westergaard O, Jakobsen BK.Identification of the C-terminal activator domain in yeast heat shock factor: independent control of transient and sustained transcriptional activity.//EMBO J.- 1993.- Т.12.-№13.-С. 5007-18 .

61. Chen Z.Y., He Z.Y., He C., Lu C.L., Wu X.F. Human glial cell-line-derived neurotrophic factor: a structure-function analysis.// Biochem Biophys Res Commun.Т.268.-№ 3.- С. 692–696,

62. Chen Z., He Z., He C., Lu C., Wu X. A structure-function analysis of human GDNF .

//Acta Biochimica et Biophysica Sinica.-2000.-Т.32.-№ 3. –С. 243–247 .

63. Christmann M, Kaina B. Transcriptional regulation of human DNA repair genes following genotoxic stress: trigger mechanisms, inducible responses and genotoxic adaptation. // Nucleic Acids Res. -2013.-Т.41.-№18.- С. 8403-20 .

64. Christians E, Michel E, Renard JP.Developmental control of heat shock and chaperone gene expression. Hsp 70 genes and heat shock factors during preimplantation phase of mouse development.//Cell Mol Life Sci.- 1997. –Т.53.-№ 2.- С. 168-78 .

65. Cuesta R, Laroia G, Schneider RJ. Chaperone hsp27 inhibits translation during heat shock by binding eIF4G and facilitating dissociation of cap-initiation complexes. // Genes & Development.- 2000.-Т. 14.-С. 1460–1470 .

66. Cunningham LA, Su C.Astrocyte delivery of glial cell line-derived neurotrophic factor in a mouse model of Parkinson's disease.// Exp Neurol.- 2002.- Т.174.-№ 2.С.230-42 .

67. d’Anglemont de Tassigny, X., Pascual, A., and Lpez-Barneo, J. GDNF-based therapies, GDNF-producing interneurons and trophic support of the dopaminergic nigrostriatal pathway. Implications for Parkinson’s disease.// Front. Neuroanat.- 2015.-Т. 9.- С.10 .

68. Dai C, Whitesell L, Rogers AB, Lindquist S.Heat shock factor 1 is a powerful multifaceted modifier of carcinogenesis.//Cell. -2007.- Т.130.-№ 6.-С. 1005-18 .

69. Davies AM. The neurotrophic hypothesis: where does it stand? // Philos Trans R Soc Lond B Biol Sci.- 1996.- Т.351.-№ 1338.-С.389-94 .

70. Davies JA, Millar CB, Johnson EM Jr, Milbrandt J. Neurturin: an autocrine regulator of renal collecting duct development. //Dev Genet.- 1999.-Т.24.-№ 34.-С. 284-92 .

71. de Graaff E, Srinivas S, Kilkenny C, D'Agati V, Mankoo BS, Costantini F, Pachnis V .

Differential activities of the RET tyrosine kinase receptor isoforms during mammalian embryogenesis.//Genes Dev.- 2001.- Т.15.-№ 18.-С.2433-44 .

72. Do Thi NA, Saillour P, Ferrero L, Dedieu JF, Mallet J, Paunio T.Delivery of GDNF by an E1,E3/E4 deleted adenoviral vector and driven by a GFAP promoter prevents dopaminergic neuron degeneration in a rat model of Parkinson's disease. //Gene Ther.Т.11.-№ 9.-С.746-56 .

73. Durbec P, MarcosGutierrez CV, Kilkenny C, Grigoriou M, Wartiowaara K,Suvanto P, S mith D, Ponder B, Costantini FD, Saarma M, et al. GDNF signalling through the Ret receptor tyrosine kinase. //Nature.- 1996.-Т. 381.-С.789–793 .

74. Eigenbrot C, Gerber N. X-ray structure of glial cell-derived neurotrophic factor at 1.9 A resolution and implications for receptor binding. // Nat Struct Biol. -1997.- Т.4.-№ 6.С.435-8 .

75. Eketjll S, Fainzilber M, Murray-Rust J, Ibez CF.Distinct structural elements in GDNF mediate binding to GFRalpha1 and activation of the GFRalpha1-c-Ret receptor complex. //EMBO J. -1999.- Т.18.-№ 21.- С. 5901-10 .

76. Ellis RJ, van der Vies SM. Molecular chaperones. // Annu Rev Biochem.- 1991.-Т.60.С.321-47. Review .

77. Enomoto H, Crawford PA, Gorodinsky A, Heuckeroth RO, Johnson EM Jr, Milbrandt JRET signaling is essential for migration, axonal growth and axon guidance of developing sympathetic neurons. //Development.- 2001.- Т.128.-№20.-С. 3963-74 .

78. Enomoto H.Regulation of neural development by glial cell line-derived neurotrophic factor family ligands.// Anat Sci Int. -2005.- Т.80.-№1.-С.42-52. Review .

79. Ericson C, Georgievska B, Lundberg C. Ex vivo gene delivery of GDNF using primary astrocytes transduced with a lentiviral vector provides neuroprotection in a rat model of Parkinson's disease. // Eur J Neurosci.- 2005.- Т.22.-№ 11.-С. 2755-64 .

80. Fernandes M, Xiao H, Lis JT.Fine structure analyses of the Drosophila and Saccharomyces heat shock factor--heat shock element interactions.// Nucleic Acids Res.Т.22.-№2.-С.167-73 .

81. Fischer W.Nerve growth factor reverses spatial memory impairments in aged rats. // Neurochem Int.- 1994.- Т.-25.-№1.-С. 47-52 .

82. Frade JM, Bovolenta P, Rodrguez-Tbar A.Neurotrophins and other growth factors in the generation of retinal neurons. // Microsc Res Tech.- 1999.- Т.45.-№ 4-5.-С. 243-51 .

83. Fujimoto M, Izu H, Seki K, Fukuda K, Nishida T, Yamada S, Kato K, Yonemura S, Inouye S, Nakai A.HSF4 is required for normal cell growth and differentiation during mouse lens development.//EMBO J. -2004.- Т.23.-№ 21.-С.4297-306 .

84. Fundin, B.T., Mikaels, A.,Westphal, H., Ernfors, P.P. A rapid and dynamic regulation of GDNF-family ligands and receptors correlate with the developmental dependency of cutaneous sensory innervation. Development. -1999. –T. 126, 2597–2610 .

85. Fukuda T, Kiuchi K, Takahashi M.Novel mechanism of regulation of Rac activity and lamellipodia formation by RET tyrosine kinase.// J Biol Chem.- 2002.- Т.277.-№ 21.С.19114-21 .

86. Gabai VL, Sherman MY.Invited review: Interplay between molecular chaperones and signaling pathways in survival of heat shock. //J Appl Physiol (1985).- 2002. Т.92.-№ 4 .

–С. 1743-8. Review .

87. Gardell LR, Wang R, Ehrenfels C, Ossipov MH, Rossomando AJ, Miller S, Buckley C, Cai AK, Tse A, Foley SF, Gong B, Walus L, Carmillo P, Worley D,Huang C, Engber T, Pepinsky B, Cate RL, Vanderah TW, Lai J, Sah DW, Porreca F.Multiple actions of systemic artemin in experimental neuropathy. //Nat Med.- 2003.- Т.9.-№ 11.-С.1383-9 .



Pages:   || 2 |



Похожие работы:

«Лист изменений № Дата Основание Вид изменения изменения изменения 1. Целевой раздел основной образовательной программы основного общего образования 1.1 . Пояснительная записка 1.1.1.Цели и задачи реализации основной образовательной программы основного общего образования 1.1.2.Принципы и подходы к формированию образоват...»

«УДК 631.47 ПОЧВЕННО-ЭКОЛОГИЧЕСКОЕ МИКРОРАЙОНИРОВАНИЕ – НЕОБХОДИМОЕ ЗВЕНО В СИСТЕМЕ ПОЧВЕННОГО РАЙОНИРОВАНИЯ А.Ф. Черныш1, Ю.П.Качков2, О.Ф.Башкинцева2, Е.Е . Давыдик2, О.Ю.Панасюк3 Институт почвоведения и агрохимии, г. Минск, Беларусь Белорусский государственный университет...»

«Министерство образования и науки Российской Федерации Московский физико-технический институт (государственный университет) Факультет молекулярной и биологической физики Кафедра физики высокотемпературных процессов СБОРНИК ПРОГРАММ КУРСОВ по магистерской программе "Физика высокотемпературных процессов" 511632...»

«Самарская Лука. 2008. – Т. 17, № 3(25). – С. 650-000. © 2008 А.Н. Дзюбан, Л.А. Выхристюк, Е.П. Романова НИНА НИКОЛАЕВНА ГУСЕВА (1913-1995) Dzuban A.N., Vychristuk L.A., Romanova E.P. Nina Nikolaevna Guseva (1913-1995) Нина Николаевна Гусева – одна из самых первых сотрудников Куйбышевской биологической станции, которые с...»

«Инженерный вестник Дона, №4 (2017) ivdon.ru/ru/magazine/archive/n4y2017/4602 Переход между форматами файлов записи многоканальных биологических и физиологических сигналов Р.Б. Таов, С.А. Синютин Южный федеральный университет, Таганрог Аннотация: В статье рассмотрены аспекты с...»

«oloro4crofi o 6l acru.{enapravreur 6p a:oB aHr4r B o aBToHoMHoe o6pasoBareJrbHoe yqpexAeHlre AononHzTenbHoro o6pasonaHus Bororo4crofi o6lacrz PerzouarsHrrfi ueHTp AolonHr4TeJrbHofo o6pa:oeanrax 4erefi IIPZH'TO YTBEPXAAIO IIeAaIOD4rIeCKr4M COBeTOM.{upe5rop lIp AOY AO BO ( eHTp OT aHvrs. II...»

«КОНСТИТУЦИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральный закон от 12 июня 2002 года № 67-ФЗ "Об основных гарантиях избирательных прав и права на участие в референдуме граждан Российской Федерации" ( в редакции Федерального Закона от 4 и...»

«Управление образования администрации муниципального образования городского округа "Усинск" "Усинск" кар кытшын муниципальнй юкнлн администрацияса йзс велдмн веськдланiн Муниципальное бюджетное общеобразовательное учреждение "Средняя общеобразовательная школа...»

«Кочешкова Алина Александровна Молекулярно-генетический анализ генов Viviparous-1 дикорастущих сородичей пшеницы Специальность: 03.02.07 – генетика, 03.01.06. – биотехнология (в том числе бионанотехнологии) на соискание ученой степени кандидата биологических наук Научный руководитель: Доктор биологических наук...»

«© Н.К. Алгебраистова, А.С. Маркова, И.В. Прокопьев, А.В. Развязная, 2016 Н.К. Алгебраистова, А.С. Маркова, УДК 622.765.063.2 И.В. Прокопьев, А.В. Развязная К ПРОБЛЕМЕ ПОДГОТОВКИ КОЛЛЕКТИВНЫХ КОНЦЕНТРАТОВ К ЦИКЛУ СЕЛЕКЦИИ Основная проблема при обогащении полиметаллических руд – это селекция коллективных концентратов, так как от е...»

«УДК 612.815+614.873.23]:616-092.9 РЕАКТИВНОСТЬ К НОРАДРЕНАЛИНУ АРТЕРИЙ ЗАДНЕЙ КОНЕЧНОСТИ КРОЛИКА ПРИ РАБОТАЮЩИХ МЫШЦАХ Ананьев В.Н.1, Демидов В.А.2, Ананьев Г.В.3 ГНЦ РФ Институт медико-биологических проблем РАН, Москва, e-mail:...»

«Ізденістер, нтижелер – Исследования, результаты. №2 (74) 2017 ISSN 2304-3334-02 _4. Курченко Ф.П., Иванющенков В.Н., Уфимцев К.П. и др. Эффективность сухой вирусвакцины из штамма НИСХИ против оспы овец// Вет...»

«Мониторинг материалов печатных и электронных СМИ по темам ЭНЕРГОЭФФЕКТИВНОСТЬ, ЭНЕРГОСБЕРЕЖЕНИЕ Исполнитель: ООО "Новое время"Дата предоставления: 27.06.2014 г. Москва, июнь 2014 ИА "Новое время". Мониторинг СМИ.Оглавление мо...»

«ЭКОЛОГИЧЕСКИЙ МОНИТОРИНГ ГОРОДОВ ООО "Горный-ЦОТ" КОМПЛЕКСНАЯ АВТОМАТИЗИРОВАННАЯ СИСТЕМА КОНТРОЛЯ ВЫБРОСОВ ЗАГРЯЗНЯЮЩИХ ВЕЩЕСТВ комплекс инновационного автоматизированного оборудования с использованием элементов искусственной нейронной сети для проведения непрерывного экологического мониторин...»

«Областной институт усовершенствования учителей ОО "Педагогическая ассоциация ЕАО РФ" Лидеры образования ЕАО 2007 Мастер-класс победителя ПНПО – 2007 для учителей биологии г. Биробиджан, 2007 год -1Лидеры образования ЕАО 2007. Мастер-класс победителя ПНПО 2007 для...»

«2. Pustovalova, M. P.Solar energy [Electronic resource] / M. P. Pustovalova; Sci. adv. S. N. Chegrincev, T. G. Petrasheva 3. Казанов А. М. Резервирование теплоснабжения электрическими теплогенераторами / А. М. Казанов; Томский политехн...»

«1 ПОЯСНИТЕЛЬНАЯ ЗАПИСКА Рабочая программа по биологии 6 класс составлена на основе примерной программы основного общего образования (базовый уровень) по биологии; Пасечник В.В., Пакулова В.М., Латюшин В.В., Маш Р.Д. (35 часов, 1 час в неделю) Рабочая программа соответствует требованиям федерального государственного образовательного с...»

«Ізденістер, нтижелер – Исследования, результаты. № 3 (75) 2017 ISSN 2304-334-02 6. Харитонов М.В. Эпизотологическая роль синатропных птиц, в поддержании эпизоотического процесса в стационарно неблагополучных по пастереллезу хозяйствах // Ветеринарный консультант. – 2008....»

«Владимир Авдеев ГЕНЕТИЧЕСКИЙ ДЕТЕРМИНИЗМ ДЖ. ФИЛИППА РАШТОНА "Как известно, деревянные ноги не передаются по наследству, чего нельзя сказать о деревянных головах" Майкл Рьюз, канадский биолог Во введении к своему фундаментальному...»

«УДК 602.6(075.8) ББК 28.04я73+30.16я73 Х89 Печатается по решению Редакционно-издательского совета Белорусского государственного университета Р е ц е н з е н т ы: кандидат химических наук, доцент В. Н. Леонтьев; кандидат биологических наук, доцент А. М. Ходосовская Храмцова, Е. А. Х...»

«ОСНОВНАЯ ПРОФЕССИОНАЛЬНАЯ ОБРАЗОВАТЕЛЬНАЯ ПРОГРАММА ПОДГОТОВКИ БАКАЛАВРА по направлению 05.03.06 Экология и природопользование профиль Экология Б. 1.32 Методы экологических исследований Приложение 1 Типовые задания для прове...»

«ТЕХНОЛОГИИ И МАТЕРИАЛЫ ПОЛИМЕРНЫЕ ТРУБЫ №4(22) / ДЕКАБРЬ 2008 В РОССИИ УСПЕШНО ВВЕДЕН В ЭКСПЛУАТАЦИЮ САМЫЙ МОЩНЫЙ РАЗРУШИТЕЛЬ ТРУБ В МИРЕ Евгений Гумен Генеральный директор ООО "БАЛТПРОЕКТ" Информационно-аналитический журнал ПОЛ...»




 
2019 www.mash.dobrota.biz - «Бесплатная электронная библиотека - онлайн публикации»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.