WWW.MASH.DOBROTA.BIZ
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - онлайн публикации
 

«Кочешкова Алина Александровна Молекулярно-генетический анализ генов Viviparous-1 дикорастущих сородичей пшеницы ...»

1

ФГБОУ ВО «РОССИЙСКИЙ ГОСУДАРСТВЕННЫЙ АГРАРНЫЙ

УНИВЕРСИТЕТ –

МСХА ИМЕНИ К.А. ТИМИРЯЗЕВА»

На правах рукописи

Кочешкова Алина Александровна

Молекулярно-генетический анализ генов Viviparous-1

дикорастущих сородичей пшеницы

Специальность:

03.02.07 – генетика,

03.01.06. – биотехнология (в том числе бионанотехнологии) на соискание ученой степени кандидата биологических наук

Научный руководитель:

Доктор биологических наук Карлов Г.И .

Москва 2016 Оглавление Оглавление ВВЕДЕНИЕ

ГЛАВА 1 ОБЗОР ЛИТЕРАТУРЫ

1.1 Пшеница как важнейшая сельскохозяйственная культура......... 9

1.2 Предуборочное прорастание зерна как фактор, влияющий на качество урожая пшеницы

1.2.1 Покой семян как стратегия выживания растений.................. 10 1.2.2 Предуборочное прорастание

1.2.3 Механизм прорастания

1.2.4 Оценка на устойчивость к предуборочному прорастанию... 15 1.2.5 Генетические аспекты устойчивости к предуборочному прорастанию

1.3 Ген Viviparous-1

1.3.1 Ген Viviparous-1 как часть эмбриогенеза

1.3.2 Ген Viviparous-1 у пшеницы

1.3.3 Функционирование генов Viviparous-1

1.4 Филогения пшеницы и пыреев



1.4.1 Геномный состав пшеницы

1.4.2 Генетические ресурсы для улучшения пшеницы

1.4.3 Таксономия трибы пшеницевых

1.4.4 Филогенетика видов пырея

1.5 Биологическое описание дикорастущих сородичей пшеницы.. 35 1.5.1 Thinopyrum intermedium

1.5.2 Thinopyrum ponticum

1.6 Пшенично пырейные гибриды

1.6.1 История пшенично-пырейных гибридов

1.6.2 ППГ как ценный источник морфологического разнообразия 1.6.3 ППГ как ценный источник генетического разнообразия...... 44 1.6.3.1 ППГ как источник хозяйственно-ценных признаков.... 44 1.6.3.2 Генетический полиморфизм ППГ

1.7 Молекулярные маркеры в селекции пшеницы

1.7.1 Определение понятия «молекулярные маркеры».................. 47 1.7.2 Создание молекулярных маркеров.

1.7.3 Применение молекулярных маркеров в селекции растений. 49 1.7.4 Классификация молекулярно-генетических маркеров.......... 49 1.7.5 Молекулярные маркеры гена Viviparous-1 мягкой пшеницы51 2 ГЛАВА 2 МАТЕРИАЛЫ И МЕТОДЫ

2.1 Растительный материал

2.2 Методы исследования

2.2.1 Выделение ДНК из растительного материала

2.2.2 ПЦР-анализ

2.2.3 Секвенирование и анализ частичных последовательностей гена Vp-1 58 2.2.4 Оценка коллекции ППГ на устойчивость к предуборочному прорастанию

2.2.5 Статистический анализ данных.

3 ГЛАВА 3 РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

3.1 Секвенирование частичных последовательностей гена Vp-1 у дикорастущих сородичей пшеницы

3.1.1 Клонирование гаплотипов гена дикорастущих Vp-1 сородичей пшеницы

3.1.2 Сравнительный анализ полученных нуклеотидных последовательностей дикорастущих видов

3.1.2.1 «Часть I» экзон 1 гена Vp-1

3.1.2.2 «Часть II» 1-3 экзоны, 1-3 интроны гена Vp-1............... 75 3.1.2.3 «Часть III» 3-5 экзоны, 3-5 интроны гена Vp-1.......... 82 3.1.2.4 «Часть IV» 5-6 экзоны, 5-6 интроны гена Vp-1............. 90



3.2 Гипотетический полноразмерный ген Vp-1 дикорастущих сородичей пшеницы

3.3 Филогенетический анализ гипотетических полноразмерных последовательностей гена Vp-1 дикорастущих сородичей пшеницы........ 102

3.4 Разработка молекулярного маркера, позволяющего отличать ген Vp-1 пырейного происхождения от генов Vp-1 мягкой пшеницы............. 109 3.4.1 Молекулярный CAPS-маркер Vp1BB4-HaeIII

3.4.2 Молекулярный маркер Vivip

3.5 Анализ полиморфизма коллекции пшенично пырейных гибридов 116 3.5.1 Оценка коллекции ППГ на показатели покоя семян........... 116

3.6 Анализ влияния гена ряда генотипических и морфологических признаков на устойчивость к предуборочному прорастанию у ППГ........ 124 3.6.1 Анализ влияния гена Viviparous-1 пырейного происхождения на устойчивость к предуборочному прорастанию у ППГ

3.6.2 Анализ влияния гена пшеничного Viviparous-1 происхождения на устойчивость к предуборочному прорастанию у ППГ 3.6.3 Анализ влияния окраски зерна на устойчивость к предуборочному прорастанию у ППГ

3.6.4 Анализ взаимосвязи между устойчивостью к предуборочному прорастанию, аллельным состоянием гена Vp-1 пырейного происхождения и интенсивностью окраски зерна у ППГ.... 134 ЗАКЛЮЧЕНИЕ

ВЫВОДЫ

СПИСОК ЛИТЕРАТУРЫ

ПРИЛОЖЕНИЕ

ВВЕДЕНИЕ

Актуальность темы. Мягкая пшеница (Triricum aestivum L.) является важной сельскохозяйственной культурой, занимающей ведущие позиции в мировом производстве зерна. C учетом роста населения Земли спрос на пшеницу продолжает расти. Однако стабильное получение урожаев сталкивается с рядом проблем. Прорастание на корню для пшеницы является одним из препятствий для производства зерна, так как оно серьезно ухудшает качество конечного продукта – муки. В частности, при прорастании семени синтез -амилазы приводит к распаду крахмала и производству хлеба с более низким уровнем объема и липкой структурой мякиша (Chang, 2010) .

Единственным способом решения данной проблемы является создание устойчивых к прорастанию на корню сортов .

Предуборочное прорастание происходит вследствие нарушения периода покоя. Ген Viviparous-1 (Vp-1) является одним из важных регуляторов позднего эмбриогенеза у пшеницы и других злаковых культур .

Изучение генов-ортологов Vp-1 различных культур, показало, что они кодируют факторы транскрипции, характеризующиеся высоким уровнем экспрессии в развивающихся эмбрионах семян. Ген выполняет две различных функции: первая – обеспечение созревания зародыша, вторая – регуляция перехода семени в покой и ингибирование прорастания .

Анализ структуры и функционирования гена Vp-1 у различных злаков, может дать новые сведения о механизмах взаимодействия генетических систем в растительном организме, а также понять принципы регуляции толерантности к прорастанию на корню. Все это в целом позволит разработать новые подходы к борьбе с прорастанием зерновых культур на корню, с использованием направленного трансгеноза или направленной интрогрессии методами отдаленной гибридизации .





Одним из перспективных методов интрогрессии чужеродных генов в геном мягкой пшеницы является использование в качестве селекционного мостика октоплоидных пшенично-пырейных гибридов (ППГ). Они, в том числе, являются удобным модельным объектом для предварительного изучения проявления пырейных генов в присутствии полного генома пшеницы. Также ППГ имеют большой потенциал и как самостоятельная культура. Они обладают такими хозяйственно-ценными признаками, как многолетность, морозостойкость, толерантность к многим абиотическим факторам, устойчивость к болезням и вредителям (Hayes et al., 2012; Larkin and Newell, 2014). В последние годы вновь возрос интерес к ППГ, как к самостоятельной сельскохозяйственной многолетней культуре, способной снизить нагрузку на окружающую среду, уменьшить затраты на возделывание и давать стабильные урожаи на маргинальных почвах (Lloyd, 2015). Но до настоящего времени не было данных об уровне толерантности к прорастанию на корню у пшенично-пырейных гибридов .

Цель нашего исследования было изучение генов Viviparous-1 (Vp-1) дикорастущих сородичей пшеницы .

Для достижения указанной цели были поставлены следующие задачи:

Клонирование и секвенирование гаплотипов гена Vp-1 у видов Thinopyrum intermedium, Thinopyrum ponticum, Thinopyrum bessarabicum, Pseudoroegneria spicata и Dasypyrum villosum;

Биоинформационный и филогенетический анализ полученных нуклеотидных последовательностей генов Vp-1;

Создание молекулярного маркера на гены пырейного Vp-1 происхождения;

Изучение полиморфизма коллекции пшенично-пырейных гибридов по признаку толерантности к предуборочному прорастанию;

Анализ полиморфизма коллекции пшенично-пырейных гибридов по генотипическим и морфологическим признакам, ассоциированным с толерантностью к предуборочному прорастанию .

Научная новизна. Впервые получены нуклеотидные последовательности различных гаплотипов гена дикорастущих Vp-1 сородичей пшеницы: Th. intermedium, Th. ponticum, Th. bessarabicum, Ps .

spicata и D. villosum .

На основе различий в полученных нуклеотидных последовательностях созданы два молекулярных маркера позволяющие идентифицировать и выявить различные аллельные варианты генов пырейного Vp-1 происхождения в геномном окружении пшеницы .

Впервые изучен полиморфизм уникальной коллекции октоплоидных пшенично-пырейных гибридов (ППГ) по ряду генотипических и морфологических признаков оказывающих влияние на устойчивость к предуборочному прорастанию. Методами ассоциативной генетики впервые показано влияние гена Vp-1 пырейного происхождения, выявляемого с помощью разработанных молекулярных маркеров, на устойчивость к предуборочному прорастанию .

Теоретическая и практическая значимость. Результаты, полученные в работе, имеют теоретическое значение для изучения полиморфизма, функционирования и эволюции генов, отвечающих за покой семени, у злаков .

Созданные молекулярные маркеры на гены пырейного Vp-1 происхождения могут быть использованы в маркер-опосредованной селекции. Полученные результаты по оценки коллекции пшеничнопырейных гибридов могут служить основанием для планирования селекционной работы (создание модели сорта, подбор пар для скрещивания) по мягкой пшенице и ППГ .

Методология и методы диссертационного исследования .

Диссертационная работа выполнена с использованием классических и современных методов молекулярной генетики, на современном оборудовании. Подробно методология и методы исследования отражены в разделе «Материалы и методы» .

Положения, выносимые на защиту .

1. У дикорастущих сородичей пшеницы наиболее консервативной частью гена Vp-1 является область функционального домена В3 .

2. Созданные молекулярные маркеры выявляют различные аллельные варианты генов Vp-1 пырейного происхождения .

3. Коллекция пшенично-пырейных гибридов обладает полиморфизмом по устойчивости к предуборочному прорастанию, морфологическим признакам и аллельному составу генов пырейного Vp-1 происхождения .

4. Гены Vp-1 пырейного происхождения, выявляемые с помощью созданных молекулярных маркеров, в присутствие генома мягкой пшеницы, оказывает влияние на устойчивость к предуборочному прорастанию .

Апробация работы. Результаты проведенных исследований были доложены на 4 конференциях: на XIII молодежной научной конференции «Биотехнология в растениеводстве, животноводстве и ветеринарии» (Москва, на научной конференция молодых ученых и специалистов, 2013), посвященной 170-летию со дня рождения К.А. Тимирязева (Москва, 2013), на научной конференции «Современные проблемы биохимии и биотехнологии»

(Уфа, 2013), на Международной научной конференции молодых ученых и специалистов, посвященной созданию объединенного аграрного вуза в Москве (Москва, 2014) .

Личный вклад автора. Диссертационная работа является результатом исследований, проведенных с непосредственным участием автора на всех этапах: разработка программы исследований, планирование экспериментов, проведение оптимизации и разработка методов, клонирование и секвенирование фрагментов генов, оценка коллекции пшенично-пырейных гибридов на полиморфизм по морфологическим признакам, оценка на предуборочное прорастание и молекулярно-генетическая оценка коллекции, статистическая обработка полученных данных .

Публикации. По материалам диссертации опубликовано 8 работ общим объемом 1,94 п.л., в том числе 4 статьи в журналах, рекомендованных ВАК РФ .

Структура и объем диссертации. Диссертационная работа состоит из введения, литературного обзора, материала и методов исследований, результатов и обсуждения, заключения, выводов, списка цитируемой литературы, а так же приложения.

Работа изложена на 174 страницах машинописного текста, содержит 19 таблиц и 36 рисунков. Список цитируемой литературы содержит 239 источников из которых 215 на иностранном языке .

ГЛАВА 1 ОБЗОР ЛИТЕРАТУРЫ

1.1 Пшеница как важнейшая сельскохозяйственная культура Пшеница (Triticum spp.) была в числе первых окультуренных растений и в течение долгих лет служит в качестве основного продукта питания для значительной части населения планеты .

В настоящее время мягкая пшеница (Triticum aestivum L) является важнейшей зерновой культурой, занимающей первое место в российском и третье место в мировом производстве зерна. Россия занимает лидирующие позиции в производстве и экспорте зерна пшеницы (http://www.fao.org/worldfoodsituation/csdb/ru/). По данным ФАО за 2014-2015 годы каждый девятый человек в мире страдает от недоедания и для обеспечения глобальной продовольственной безопасности требуется увеличение производства зерновых, включая пшеницу, за счет повышения урожайности. При ожидаемой численности населения 9 миллиардов человек к 2050 году, для обеспечения питания, кормов и сырья для промышленности необходимо увеличить мировой сбор пшеницы с 730 млн. тонн до более чем 900 млн. тонн. Это подразумевает ежегодный темп роста производства за счет повышения урожайности на 1,6% .

Однако повышение урожайности пшеницы затруднено в связи с неблагоприятными факторами, способными негативно влиять на культуру (Ortiz et al., 2008). Одну из серьезных угроз представляют неблагоприятные погодные условия: засуха, резкие смены температур и большое количество осадков. Резкие смены температуры воздуха, обильные росы и большое количество осадков приводит к предуборочному прорастанию зерна пшеницы. Явление предуборочного прорастания пшеницы и другие злаковых культур распространено практически во всех климатических зонах Земного шара. Прорастание на корню является одним из основных препятствий для последовательного производства высококачественного зерна, так как оно серьезно ухудшает качество конечного продукта – муки. В частности, при прорастании семени синтез -амилазы приводит к распаду крахмала и производству хлеба с более низким уровнем объема и липкой структурой мякиша (Chang et al., 2010). Единственным способом решения данной проблемы является создание устойчивых сортов. Трудность в создании устойчивых к предуборочному прорастанию сортов заключается в отсутствии доноров генов такой устойчивости. Генетическая близость и ограниченный набор выращиваемых сортов также усугубляют проблему предуборочного прорастания .

1.2 Предуборочное прорастание зерна как фактор, влияющий на качество урожая пшеницы 1.2.1 Покой семян как стратегия выживания растений Предуборочное прорастание зерна является следствием нарушения покоя семян, что приводит к активации физиологических процессов и началу роста зародыша .

Явление покоя характерно для всех форм организмов, таких как семена, споры, луковицы, клубни, личинки и даже для некоторых млекопитающих. Во время периода покоя полностью приостанавливается или резко замедляется метаболическая деятельность организма. Явление покоя растений возникло в процессе эволюции как средство позволяющее пережить неблагоприятные условия: холод, засуху, нехватку питательных веществ. Покой семян – это стратегия выживания растений, который позволяет синхронизировать циклы роста и развития с сезонными изменениями климата (Jones et al., 2000). Покой семян ассоциируют с отсутствием прорастания, но отсутствие прорастания так же может быть связано и с другими факторами, такими как влияние окружающей среды и нежизнеспособность семени .

Семя – важнейшая состовляющая растительного мира. Это зародышевая стадия растения, которое образовано путем полового размножения и дает возможность пережить длительный период в состоянии покоя. Для понимания явления покоя и процесса прорастания были проведены многочисленные исследования .

Состояние покоя семян основано на генетической базе, однако на покой семян могут влиять и внешние факторы (Groos et al. 2002; Himi et al .

2002; Rathjen et al. 2007; Farley and Adkins 2007). Так, семена растений имеющих одинаковый генотип могут проявлять разный уровень покоя при разных условиях окружающей среды. Такая вариативность в состояние покоя позволяет растениям адаптироваться для выживания в различных условиях (Osborne, 1981). При этом семена, находящиеся в состоянии глубокого покоя сразу после созревания не способны к прорастанию даже при благоприятных условиях окружающей среды. У некоторых растений, в первую очередь плодовых, после созревания плода в семени продолжается развитие зародыша, в связи с этим семя не способно к прорастанию (Baskin J., Baskin C., 2004). В поддержании состояния глубокого покоя основное значение имеют ингибиторы роста, которые вырабатываются растением и содержатся в оболочке или эндосперме семян или в мякоти плодов. Благодаря ингибитору роста АБК семя не прорастает сразу после созревания, а впадает в состояние глубокого покоя. При прорастании семени содержание АБК постепенно снижается и идет накопление гиббереллинов и цитокининов (Третьяков и др., 2005). В исследовании покоя у арабидопсиса (Arabidopsis thaliana) были получены мутанты с различным уровнем покоя семян, который прерывали путем их охлаждения (Footitt et al., 2013) .

Глубокий покой является основным фактором, влияющим на устойчивость к предуборочному прорастанию семян при влажных погодных условиях (Li et al., 2004). В период доместикации растений велся отбор на улучшение прорастания и одновременную всхожесть, что возможно привело к снижению уровня покоя у современных злаковых культур .

1.2.2 Предуборочное прорастание

Предуборочное прорастание – это процесс прорастания зерновок в колосе непосредственно перед уборкой урожая (Groos et al., 2002) .

Предуборочным прорастанием считается прорастание на корню именно физиологически спелых семян (Derera, 1989) .

Общий потенциал устойчивости к предуборочному прорастанию основывается на множестве различных признаков, таких как цвет зерна, время уборки урожая, глубина покоя семян и скорость поглощения воды, скорость деградации крахмала при прорастании. Кроме того на прорастание зерна в колосе оказывает влияние его морфологическое строение: степень закрытия зерна цветковыми чешуями и прочность чешуй наличие остей, опушенность колоса, наличие воскового налета, окраска цветковых чешуй (King, 1984; Walker-Simmonds, 1987; Paterson et al., 1989; Gatford et al., 2002, Groos et al., 2002; Himi et al., 2002; Rathjen et al., 2007; Farley and Adkins 2007) .

Ряд таких просто наследуемых морфологических особенностей колоса могут влиять на интенсивность увлажнения зерна во время дождя и тем самым ограничивать предуборочное прорастание в колосе (King, 1984). Так, безостые колосья пшеницы, во время моделируемого дождя, поглощают воду более медленно, чем остистые, что уменьшает предуборочное прорастание в колосе вдвое (King & Richards, 1984) .

Семенная кожура является основным барьером, препятствующим всасыванию воды и предупреждающим предуборочное прорастание. Без защитных семенных покров вода беспрепятственно бы поступала в клетки алейронового слоя активировала -амилазу и провоцировала бы прорастание .

У сортов устойчивых к предуборочному прорастанию семена имеют плотное расположение эпидермальных клеток, которые способствуют задержке поглощения воды (Chen et al., 2008; Kong et al., 2008) .

Определенное влияние на интенсивность прорастания зерна в колосе оказывает и окраска его колосковых чешуй. Сдерживающее действие колосковых чешуй при воздействии неблагоприятных условий наиболее заметно в первые сутки при наклевывании зерна. Установлено, что больше всего сдерживают наклевывание семян вытяжки из колосковых чешуй краснозерной пшеницы, а меньше всего - из колосковых чешуй ржи (Беркутова и Буко, 1982) .

Проблема прорастания на корню распространена во всех зонах возделывания зерновых злаков. Предуборочное прорастание связано с высокой влажностью, длительными дождями и обильными росами в период созревания зерна (Nielsen et al., 1984). Усугубляет ситуацию задержки в уборке урожая, вызванные длительными осадками. Даже в районах с сухим климатом данная проблема имеет место. Например, в штате Канзас в США, характерным жарким засушливым климатом в определенные годы были зафиксированы потери урожая от прорастания на корню (Derera, 1989). В России в погодно-климатических условиях Краснодарского края проблема предуборочного прорастания встречается редко, однако, при дождливой погоде во время уборки урожая восприимчивые сорта пшеницы также прорастают на корню (Беспалова, 2012) .

Предуборочное прорастание – проблема, затрагивающая все злаковые культуры. Наиболее склонна к предуборочному прорастанию рожь (Secale cereale L.), из-за открытого строения колосковых чешуй, в связи с чем, к зерновкам легко попадает влага. У тритикале (xTriticosecale Wittmack), как и у ржи часто встречаются случаи предуборочного прорастания, что сильно влияет на качество производимой муки. Ячмень (Hordeum vulgare L.) так же подвержен данной проблеме, которая наносит ущерб производству перловой и ячневой крупы, и негативно влияет на соложение в пивоварении. В северных районах у овса (Avena sativa L.) возникают случаи предуборочного прорастания, что снижает качество производимой геркулесовой крупы .

Часто прорастание на корню затрагивает и мягкую пшеницу, это связано с большими объемами выращивания данной культуры и регионами, способствующими предуборочному прорастанию, в которых она возделывается. Прорастание зерна в колосе до уборки способствует снижению урожая и его качества. Последствия предуборочного прорастания зависят от того, для производства какого продукта будет использовано зерно .

1.2.3 Механизм прорастания

Липкость теста и сыропеклость хлеба связана с повышением активности -амилазы, что приводит к гидролизу гранул крахмала и образованию водорастворимых декстринов (Kruger, 1989) .

Идентифицировано три группы -амилаз. В первую группу входит -амилаза 1 (-Amy1), которую так же называют солодовой. В мягкой пшенице идентифицированы и локализованы на длинном плече шестой хромосомы (6AL, 6BL, 6DL) три гена-ортолога -амилазы (-Amy-A1, -Amy-B1 и -AmyD1) (McIntosh et al.,2009). Уровень экспрессии может регулироваться гибберелиновой кислотой (ГК). Уровень экспрессии второй группы «зеленой» -амилазы (-Amy2) так же регулируется ГК, но ее синтез находится под контролем седьмой гомеологичной группы хромосом. В третью группу входит термолабильный изофермент перекарпия (-Amy3) .

Mrva и Mares (2001) продемонстрировали наличие в зерне ряда генотипов амилазы позднего созревания. Ими было показано, что подобная форма фермента, приводящая к преждевременному прорастанию созревающего зерна в отсутствии высокой влажности, является результатом генетического дефекта. Данный дефект был выявлен у некоторых генотипов пшеницы .

Ферменты липазы и протеазы, также принимают участие в процессе прорастания .

При прорастании семени увеличивается активность фермента пероксидазы, которая осуществляет контроль за уровнем перекиси водорода, восстанавливая ее до воды и окисляя низкомолекулярные антиоксиданты .

При этом высокая концентрация антиоксидантов способна снижать активность фермента (Рогожин и Рогожкина, 2011) .

1.2.4 Оценка на устойчивость к предуборочному прорастанию

Существует большое количество способов оценки материала на устойчивость к предуборочному прорастанию, которые подразделяются на прямые и косвенные .

К косвенным методам оценки относится изучение колебания биохимических показателей прорастания. Наиболее часто в качестве косвенного метода оценки толерантности к предуборочному прорастанию применяют метод определения числа падения Хагберга (ЧП). ЧП является показателем активности амилолитических ферментов и применяется для установления повреждения крахмала в результате прорастания (Рубец и соавт .


, 2012; Крупнов и Крупнова, 2015). Определение активности -амилазы так же производят колориметрическим методом, измеряя изменение интенсивности окраски йодного раствора (Беркутова и Буко, 1982). Кроме того, существуют методы бумажной хроматографии, определения активности с помощью амилографа, применение высокоскоросного вискозиметра (Gavazza et al.,2006; Майер., 2011). К недостатку этого метода относится то, что он дает низкую корреляцию с уровнем предуборочного прорастания .

К прямым методам относится оценка устойчивости к предуборочному прорастанию непосредственно в поле, оценка устойчивости в защищенном грунте и оценка на прорастание с использование искусственной провокации сразу после сбора урожая .

Наиболее естественным способом оценки устойчивости к прорастанию зерна на корню является оставление посевов неубранными в поле до появления биохимических или морфологических признаков прорастания зерна (Lin et al., 2009). Однако в полевых условиях оценка осложнена из-за большого количества неконтролируемых внешних факторов, не каждый год складываются необходимые погодные условия для предуборочного прорастания зерна в поле .

Одной из наиболее приближенной к естественным условиям является оценка устойчивости к прорастанию на корню непосредственно в колосе .

Способ оценки материала на устойчивость к предуборочному прорастанию непосредственно в колосьях кроме покоя семян позволяет учитывать вклад таких факторов, как способность колосьев задерживать влагу, влияние ингибиторов прорастания, находящихся в колосковых чешуях (Liu and Bai 2010). Даный метод оценки позволяет выявить непосредственно полевую устойчивость (Беркутова и Буко, 1982). Различия между устойчивыми и не устойчивыми образцами позволяет выявить метод с использованием провокационных условий с последующим подсчетом процента проросших зерен в колосе. Для оценки устойчивости непосредственно в колосе применяют несколько вариантов провокации. Для увлажнения колосьев сконструированы специальные климатические установки. Как правило, в подобной установке срезанные колосья располагаются в вертикальном положении и подвергаются либо дождеванию, либо опрыскиванию водой, либо в установке создаётся туман. При этом поддерживается определённая температура, световой режим и осуществляется активная циркуляция воздуха (Шилов и Шилова, 1994; Mares et al., 1991) .

Другим вариантом провокации прорастания колосьев в лабораторных условиях может служить использование проращивания в чашках Петри на фильтровальной бумаге, проращивание во влажном песке, проращивание колосьев, подвешенных в перевернутом состоянии в полиэтиленовом пакете с водой, но при таких методах оценки теряется оценка влияния архитектоники колоса на устойчивость .

Методы оценки в колосьях являются чрезвычайно трудоемкими, необходим большой объем исследуемых образцов, требуют наличия специальных климатических камер или создания специальных конструкций для проведения провокации. Поэтому наиболее распространенным методом оценки покоя семян является проращивание семян в чашках Петри .

Существует множество вариаций метода оценки в чашках Петри, но существуют основные правила, которых придерживается большинство исследователей. Зерно, применяемое для анализа, должно быть обмолочено вручную, что позволяет избежать повреждения семенной оболочки, которое может повлиять на скорость впитывания влаги и соответственно скорость прорастания .

1.2.5 Генетические аспекты устойчивости к предуборочному прорастанию

Толерантность к предуборочному прорастанию сложный признак, на который оказывают свое влияние экологические условия произрастания растения и его генотип. Однако генетический аспект является основным фактором, так как влияние условий окружающей среды крайне мало, и как правило составляет менее 6% (Biddulph et al., 2008). Прорастание на корню является количественным признаком, который контролируется несколькими генами. На степень толерантности к предуборочному прорастанию могут оказывать влияние механизмы и экспрессия различных генов. В управление покоем и устойчивостью к предуборочному прорастанию могут быть вовлечены полимерные гены – локусы количественного признака (QTL) .

QTL различаются по силе влияния на устойчивость: мажорные QTL оказывают основной эффект, к ним относятся локусы, имеющие связь более чем с 10% фенотипической изменчивости. В то время как минорные QTL оказывают меньшее влияние .

Многочисленными исследованиями было идентифицировано и картировано более 100 локусов, связанных с устойчивостью к предуборочному прорастанию (Flintham и др., 2000, 2002; Kato и др., 2001;

Osa и др., 2003;. Kulwal и др., 2005;. Lohwasser и др., 2005; Kottearachchi и др., 2006; Munkvold и др., 2009; Mohan и др., 2009; Anderson et al.1993; Bailey et al. 1999; Zanetti et al. 2000; Mares et al. 2005; Ogbonnaya et al. 2006; Imtiaz et al. 2008). При этом некоторые из этих локусов могут быть идентичными .

Локусы количественных признаков (QTL,), связанные с толерантностью к предуборочному прорастанию были обнаружены на всех хромосомах, за исключением хромосомы 1D и 4D (Groos et al. 2002; Flintham et al. 2002;

Kulwal et al. 2012; Lohwasser et al. 2005; Mori et al. 2005; Kottearachchi et al .

2006; Chen et al. 2008; Ogbonnaya et al. 2008; Fofana et al. 2009; Mohan et al .

2009; Munkvold et al. 2009; Rasul et al. 2009; Liu and Bai 2010; Zhang et al .

2013). QTL, связанные непосредственно с покоем семян были локализованы на хромосомах 1A, 1B, 2A, 2B, 2D, 3А, 3В, 4А, 4В, 4D, 5B, 6В, 7А, 7В и/или 7D (Kato et al., 2001; Mares and Mrva, 2001; Osa et al., 2003; Lohwasser et al., 2005; Mares et al., 2005; Chen et al. 2008; Ogbonnaya et al., 2008; Zhang et al., 2008; Munkvold et al., 2009). Чаще всего QTL локализованы на длинных плечах хромосом. Наиболее часто встречаемой локализацией считается хромосомы третьей гомеологичной группы (3A, 3B, 3D), в этой группе насчитывается более 50 QTL .

Возможно, это связано с расположением на хромосомах 3 группы гомологов гена и Viviparous-1 Red-генов ассоциированных с устойчивостью к прорастанию на корню. QTL идентифицированные на хромосомах 3A, 3B, 3D и 4А, ответственны за проявление примерно 58,0% фенотипической вариации устойчивости к предуборочному прорастанию и за примерно 45% проявления покоя семян (Groos dr 2002; Mares et al., 2005; Kulwal et al., 2004; Mori et al., 2005;

Ogbonnaya et al., 2008; Chen et al., 2009) .

Так же QTL устойчивости к предуборочному прорастанию были идентифицированы и локализованы на всех хромосомах у ячменя и риса .

(Gao et al., 2008; Ullrich et al., 2008) .

Широко известна связь цвета зерна с устойчивостью к предуборочному прорастанию. Как правило, белозерные сорта пшеницы более подвержены прорастанию на корню, чем краснозерные. Это может быть обусловлено плейотропным эффектом генов, контролирующих красную пигментацию (R) .

Как было установлено, дефицит олигомерных проантоцианидинов вызывает более быстрое поглощение воды, что приводит к прорастанию (He et al., 2008). Возможно также, что эффект устойчивости краснозерных сортов пшеницы обусловлен сцеплением между этими генами и другими, контролирующими устойчивость к предуборочному прорастанию. R-гены локализованы на длинном плече третьей группы хромосом (3AL, 3BL, 3DL) и имеют расположение в 30 сМ от генов Viviparous-1 (Warner et al., 2000). У белозерной пшеницы все R-аллели находятся в рецессивном состоянии .

Вклад каждого из доминантных R-аллелей по отдельности не выявлен .

Красный пигмент в зерновках мягкой пшеницы накапливается путем биосинтеза флавоноидов, за счет экспрессии дигидрофлаванол-1,4-редуктазы (DFR-гена). Bi H.H. с соавторами (2014) было показано, что гомеологи TaDFR генов у мягкой пшеницы так же расположены на третьей группе хромосом и были выявлены различия влияния аллелей на толерантность к предуборочному прорастанию. Так гомеолог гена TaDFR расположенного на 3B хромосоме был выявлен аллель TaDFR-Bb, с инсерцией в 8п.н. в промоторной области гена. Белозерная пшеница обладает более высоким качеством, имеет больший спрос и возделывается на больших площадях, чем краснозерная. Предпочтение в возделывании белозерной пшеницы стимулирует селекционеров всего мира к переносу генов устойчивости к предуборочному прорастанию без R-генов в белозерную пшеницу (Bi et al., 2014) .

У арабидопсиса и дикого риса так же была выявлена связь между цветом семенной кожуры и прорастанием (Ji et al., 2006) .

1.3 Ген Viviparous-1 1.3.1 Ген Viviparous-1 как часть эмбриогенеза В виду того, что предуборочное прорастание зерна является одной важнейших проблем возникающих при выращивании зерновых злаков, в частности пшеницы, необходимо изучить механизм покоя и прорастания семян .

Исследования на различных культурах показали, что ген Vp-1 является важнейшим регулятором позднего эмбриогенеза. Крупномасштабными исследованиями, проведенными на кукурузе, было продемонстрировано, что в функции гена входят активирование транскрипции генов, Vp-1 ответственных за завершение созревания и подавление транскрипции генов, ответственных за прорастание (Hoecker et al., 1995; McCarty et al., 1991; Paek et al., 1998) .

Ортологи гена Vp-1 идентифицированы у кукурузы, пшеницы, риса, овса, моркови и ортолог гена Vp-1 у арабидопсиса Insensitive3 (ABI3). Они кодируют факторы транскрипции, которые характеризуются высоким уровнем экспрессии в развивающемся семени (Cao et al., 1992; Simpson et al., 1990; Shen et al.,2001; Utsugi et al.,2006). В развивающемся алейроне злаковых культур, в частности кукурузы и риса Vp-1-гены активируют транскрипцию многих регулируемых АБК-генов (Ezcurra et al., 2000; Shen et al., 2001; Smith et al., 1994; Zentella et al., 2002). В клетках алейрона кукурузы и ячменя Vp-1 осуществляется низкоуровневая регуляция экспрессии амилазы (Hoecker et al., 1999; Sjakste et al., 2006; Ullrich et al., 2008). Таким образом, все ортологи гена Vp-1 представляет собой бифункциональный фактор транскрипции, действующий во время развития семени одновременно как активатор и как репрессор (Hoecker et al., 1999; Himmelbach et al., 2003) .

Кроме правильного завершения созревания семени, ген Vp-1 учувствует в регуляции перехода от состояния покоя к прорастанию в ответ на АБК. На кукурузе было показано, что мутация по гену Vp-1 приводит к образованию зерен с уменьшенной чувствительностью АБК, не способных к нормальному завершению созревания (McCarty et al., 1989). В ходе исследований Yamaguchi-Shinozaki и Shinozaki (2005) по экспрессии гена, индуцированной АБК, был выявлен АБК-отзывчивый элемент (ABRE) .

Данному элементу требуется АБК для индукции множества генов растения .

Связанные с ABRE белки относятся к bZIP факторам транскрипции, в том числе к ABI5 и TRAB1 белкам арабидопсиса и риса (Finkelstein and Lynch, 2000). Белок TRAB1совместно с АБК индуцируют экспрессию гена Osem в протопластах риса (Hobo et al., 1999) .

Гены Vp-1 у различных культур содержат функциональные белковые домены: B1, B2, B3, которые активируют целевой промотор, связываясь с ДНК (Cao et al., 1992; Jacobsen and Close, 1991; Kushiro et al., 2004; Nakamura and Toyama, 2001; Utsugi et al.,2006). Домен B1 учувствует в физическом взаимодействии ортолога ABI3 у арабидопсиса с основными доменами лейциновой застежки (bZIP), такими как ABI5 или EmBP1, необходимыми для активизации промотора Em. Следовательно, B3 домен активизирует транскрипцию промоторов генов, например ответственных за Em, кодирование обогащенных белков позднего эмбриогенеза (LAE) (Bobb et al., 1995; Ezcurra et al., 2000; Giraudat et al., 1992; McKibbin et al., 2002; Shiota et al., 1998; Suzuki et al., 1997; Vasil et al., 1995). Домен B3 у кукурузы принимает участие в АБК-независимой активации промотора гена С1, который регулирует синтез антоциана. B3 домен связывается непосредственно с элементом Sph на промоторе гена. В то же время домены B2 и B3 в Brassica napus необходимы для АБК-зависимой регуляции napA (Schultz et al., 1998) .

Было выдвинуто предположение, что ген Vp-1 может выполнять функции QTL устойчивости к предуборочному прорастанию (Крупнов, 2010) .

–  –  –

На длинных плечах третьей группы хромосом мягкой пшеницы было картировано три гена-гомеолога Данное положение является Vp-1 .

постоянным относительно гена Vp-1 у других культур, например гена Vp-1 у кукурузы и гена Osvp1 у риса. У пшеницы расположение гена на хромосоме находится на расстоянии 30 сМ от центромеры и на расстоянии 30 сМ от Rгенов, обуславливающих окраску зерна (Bailey et al., 1999) .

Исследования Nakamura и Toyama (2001) показали более высокий уровень экспрессии гена TaVp-1 в зрелых покоящихся семенах устойчивого сорта пшеницы Minamino-komugi (Minamino), чем вне периода покоя в семенах восприимчивого сорта Tozan-18. Они установили, что уровень мРНК TaVp1в этих сортах пшеницы положительно коррелирует с покоем семян .

McKibbin и др. (2002) продемонстрировали, что клоны гомеологов TaVp1, на основании их нуклеотидных последовательностей в гексаплоидной пшенице Soleil, разделяются на три класса – по одной копии в субгеномах A, B и D .

Принято обозначение локусов в мягкой пшенице TaVp-A1, TaVp-B1 и TaVpD1, относящихся к геномам A, B и D соответственно. Гомеологи гена Vp-1 показывают высокую степень гомологии между друг другом, однако каждый из них имеет уникальную последовательность в 3’UTR области и у TaVp-B1 в экзоне I присутствует делеция в 12-bp .

Показано наличие альтернативного сплайсинга этих генов. Известно, что неправильный сплайсинг прематричной РНК TaVp1 происходит за счет вырезания домена B3, что приводит к синтезу обрезанных мРНК и терминирующих кодонов в открытой рамке считывания (McKibbin et al., 2002). Альтернативный сплайсинг был обнаружен у ячменя, ржи и у диплоидных и тетраплоидных сородичей пшеницы Brachypodium pinnatum, Agropyron, Elymus, и Thinopyrum scripeum.. Эти данные об альтернативном сплайсинге позволяют сделать предположение о наследовании структуры TaVp1 от предковых форм до доместикации (Wilkinson et al., 2005; Yang et al., 2007) .

Было показано, что TaVp1 избирательно экспрессируется в семенах мягкой пшеницы. Во время развития и созревания семени уровень мРНК увеличивается. В частности, транскрипты TaVp-B1, прошедшие корректный сплайсинг, находились в существенно более высокой пропорции среди транскриптов в семенах сорта устойчивого к TaVp1 Minamino, предуборочному прорастанию, на последних стадиях развития и в зрелых семенах, что позволяет предполагать, что TaVp-B1 - важный ген для покоя семян .

1.3.3 Функционирование генов Viviparous-1

Анализ развивающихся эмбрионов пшеницы продемонстрировал, что все гомологи гена Vp-1 способны кодировать функциональный белок (McKibbin et al., 2002; Wilkinson et al., 2005). Однако McKibbin и др. (2002) показали, что альтернативный сплайсинг приводит к неправильному соединению большого количества транскриптов. Путем сравнения клонов TaVp-A1, TaVp-B1 и транскриптов TaVp-D1 у мягкой пшеницы выделено шесть типов транскриптов (Рис. 1). Тип I получен путем корректного сплайсинга, тогда как Тип II был получен из-за сплайсинга отличающегося от стандартного сайта на 3 п.н., находящегося между интроном II и экзоном III (рис. 1.B) (Utsugi et al., 2008). Из II типа транскрипта получен белок, с одним аминокислотным остатком (лизином), добавленным к домену B3. В этом случае, сплайсеосома может узнавать последовательность AG, которая расположена вверх на 3-bp от оригинального участка узнавания как сайт сплайсинга (рис. 1.C) .

Транскрипты III типа имеют нефункционирующий белковый продукт, что может быть связано с отсутствием большой аминокислотной части (310аминокислот) между доменами B1 и B2. Белковые продукты IV, V и VI типа транскриптов полностью лишены домена B3, так как некорректный сплайсинг происходит вокруг интрона I. В транскриптах IV, V и VI типа имеются стоп-кодоны терминирующие трансляцию и приводящие к синтезу дефектных белков .

Рис. 1. Структура гена TaVp1 и его транскриптов в Minamino (Utsugi et al., 2008) .

Между гомеологами TaVp1 не было обнаружено значительных различий в последовательностях, окружающих участки подверженные некорректному сплайсингу. Однако были выявлены значительные различия в геномной последовательности интрона I, это дает возможность предположить, что последовательности интрона I могут быть ответственны за различия в некорректном сплайсинге у каждого гомеолога .

Как известно Vp-1 гены служат активаторами транскрипции многих регулируемых АБК генов управляющих созреванием семени и его прорастанием (Cao et al., 1992; Ezcurra et al., 2000; Utsugi et al.,2006) .

Эмбрионы пшеницы в ответ на АБК, ингибирующую прорастание, поддерживают высокий уровень транскрипта TaVp1. В зрелых эмбрионах семян мягкой пшеницы, обладающей периодом покоя, идет накопление большего количества мРНК TaVp1, чем у пшеницы, не обладающей периодом покоя. Выше изложенные данные позволяют предположить наличие положительной корреляции между покоем семян, уровнем мРНК TaVp1 и чувствительность к АБК в зрелых эмбрионах (McKibbin et al., 2002) .

Однако McKibbin и др. (2002) было показано, что значительная доля пре-мРНК TaVp1 проходила через некорректный сплайсинг, приводящий к синтезу большого количества нефункциональных белков .

У овсюга (Avena fatua) экспрессия Vp-1 гена является следствием взаимодействия между генотипом и окружающей средой. Jones и др. (1997) показано, что между уровнем мРНК AfVp1 и покоем семян существует тесная корреляция. Опыты с трансгенной пшеницей, несущей ген AfVp1 из Avena fatua продемонстрировали, что созревающие колосья были более устойчивы к прорастанию на корню (McKibbin et al., 2002). На основании полученных результатах было выдвинуто предположение, что некорректный сплайсинг транскриптов у пшеницы способствует восприимчивости к Vp-1 предуборочному прорастанию. Образцы мягкой пшеницы, показывающие высокую способность к корректному сплайсингу большинства пре-мРНК TaVp1, обладают наиболее глубоким состоянием покоя и проявляют сильную устойчивость к предуборочному прорастанию (Utsugi et al., 2006) .

Изучение структуры экспрессии TaVp1 показало большее накопление мРНК TaVp1 в эмбрионах созревающих семян пшеницы, так как наблюдалось для мРНК ABI3/Vp-1 в других растениях. Накопление мРНК происходит в эмбрионах как сухих, так и увлажненных семян, но в прорастающих эмбрионах уровень накопления мРНК заметно снижается (Utsugi et al.,2006) .

Гены Vp-1 относящиеся к каждому из субгеномов мягкой пшеницы (A, B и D) имеют различные уровни и структуры экспрессии. У гомеолога TaVpB1 структура экспрессии схожа со структурой тотальной мРНК TaVp1, а ее уровень достигает пика в финальной стадии развития. Уровень мРНК TaVpD1 более низок в начальных стадиях и постепенно увеличивается в процессе созревания семени. Исследования Wilkinson и др. (2005) на пшенице сорта Chinese Spring показали, что большинство транскриптов TaVp1 представлены транскриптами TaVp-B1. Транскрипты, подвергнутые корректному сплайсингу, составляли 69% от общего числа транскриптов. Анализ кДНК Vp-1 гена у мягкой пшеницы показал, что гомеолог TaVp-B1 имеет открытую рамку считывания, в которую входят домены B1, B2 и B3, но в экзоне I имеется делеция в 12 пн. Несмотря на наличие делеции, TaVp-B1 несет устойчивость к предуборочному прорастанию (Wilkinson et al., 2005) .

Ряд исследователей показали, что ген осуществляет Vp-1 низкоуровневую регуляцию экспрессии -амилазы, в частности в клетках кукурузы и ячменя (Hoecker et al., 1999; Shen et al., 2001). Hoecker и др .

(1999) показал, что в кукурузе экспрессия -амилазы в алейронах усилена в развивающихся эмбрионах, гомозиготных по аллелю vp1, который блокирует трансдукцию сигнала АБК или по аллелю vp5, который блокирует синтез АБК .

Они также обнаружили, что экспрессия -амилазы была так же усилена в алейроне семян, гомозиготных по аллелю emb-2008, который блокирует развитие эмбриона на ранних этапах. Было выдвинуто предположение, что в семенах дикорастущих видов, находящихся в состоянии покоя, эмбрион передает подавляющий сигнал к алейрону. Накопленные транскрипты Vp-1, как предполагается, являются, по крайней мере, частью ингибирующего сигнала, который подавляет прорастание созревающих семян зерновых .

Hoecker и др. (1999) и Shen и др. (2001) сообщали, что Vp-1 осуществляет низкоуровневую регуляцию экспрессии -амилазы в клетках алейрона в кукурузе и ячмене .

Таким образом, TaVP-B1 потенциально управляет экспрессией амилазы через ее взаимодействие с вызванными гиббереллиновой кислотой факторами транскрипции или регуляцией их экспрессии .

1.4 Филогения пшеницы и пыреев В начале XX века была поставлена проблема «генетической эрозии», связанная со сдвигом в популяционной структуре, уменьшении разнообразия мировой флоры по причине природных процессов и под влиянием отбора (Алтухов и др., 1995; Baur et al., 1914; Harlan et al., 1972). Генетическая эрозия обусловлена процессом вытеснения более продуктивными генотипами менее продуктивных и сокращением генофонда зерновых за счет потери местных и стародавних сортов (Мартынов, 2012). Современные сорта пшеницы были получены на основе ограниченной генетической базы, что привело к исчерпанию генетических ресурсов. Анализ современных сортов пшеницы, зарегистрированных в Госреестре России в период с 2002 до 2005, показал, что за исключением нескольких иностранных, все сорта являются потомками Безостой 1 и Мироновской 808 (Martynov et al., 2006;

Novosel'skaia-Dragovic. et al., 2007) .

Увеличение разнообразия аллельных вариантов для последующего привлечения их в геном пшеницы является важной частью селекции .

Генетические ресурсы играют важную роль в поддержании мирового производства пшеницы, как новые источники толерантности и устойчивости к абиотическим и биотическим факторам (Skovmand et al., 2002) .

Неисчерпаемый резерв хозяйственно-ценных признаков для селекции пшеницы представляют дикорастущие сородичи пшеницы, в том числе несколько видов пырея. Большое количество близкородственных видов пшеницы было использовано для интрогрессии полезных генов в пшеницу .

Так, в настоящее время многие устойчивые к болезням сорта несут в себе эффективные гены из этого генофонда (Jiang et al., 1994) .

1.4.1 Геномный состав пшеницы

Пшеница была одомашнена более 10 тысяч лет на Ближнем Востоке .

Молекулярно-генетические методы и археологические данные позволили сконструировать сценарий происхождения её современных видов. Мягкая пшеница аллогексаплоид, в геном которой входят три субгенома (AABBDD), унаследованных от трех разных предков. Первое событие по полиплоидизации предковой формы рода Triticeae произошло в 500 000 – 150 000 лет назад (Kellogg et al., 2001). Как представлено на Рисунке 2, в результате межвидовой гибридизации между Triticum urartu (AuAu) донором субгенома A и неизвестным, возможно вымершим видом-донором субгенома B, близким с Aegilops speltoides появился новый тетраплоидный вид пшеницы Triticum turgidum ssp. dicoccum (AuAuBB). На втором этапе была гибридизация между одомашненным тетраплоидным видом Triticum turgidum ssp. dicoccum и донором субгенома D Aegilops tauschii, в результате чего был сформирован предполагаемый предок современной мягкой пшеницы Triticum aestivum ssp. spelta L. em. Thell., (AuAuBBDD) (Charmet et al., 2011) .

Рисунок 2. Схема происхождения пшеницы (Triticum sp .

) (Charmet et al., 2011) 1.4.2 Генетические ресурсы для улучшения пшеницы Использование генетических ресурсов пшеницы важно не только для расширения потенциала урожайности, но и для доступа к новым источникам устойчивости к биотическим и абиотическим стрессам .

Генетические ресурсы трибы Triticeae подразделяется на несколько генетических пулов (Von Botmer et al., 1992). Первичный генофонд пшеницы включает формы того же биологического вида, то есть различные сорта мягкой и твердой пшеницы и доноры их субгеномов А (T. urartu) и D (Aegilops tauschii). Первичный генетический пул широко применим в улучшение пшеницы, в связи с легкостью скрещивания и переноса генов (Пухальский, 2005; Kang et al., 2009). Во вторичном генофонде, представленном близкими полиплоидными формами, имеющими хотя бы один общий геном с пшеницей (роды Triticum и Aegilops), перенос генов затруднен (Пухальский и др. 2007; Zhang et al., 2008). Третичный генофонд представлен видами, имеющими негомологичные пшенице геномы. Перенос генов из третичного генетического пула является наиболее сложным и часто требует использования различных методических подходов. Использование третичного генофонда дает возможность не только получения новых форм для дальнейшего использования в селекции, но и позволяет решать фундаментальные вопросы, касающиеся филогенетических взаимодействий между близкими видами, эволюционных процессов формообразования и изучения механизмов межгеномного взаимодействия .

1.4.3 Таксономия трибы пшеницевых

Семейство злаков (Poaceae) состоит из почти 100 однолетних и 400 многолетних видов и включает в себя такие важные одомашненные культуры, как пшеница, рожь, ячмень, тритикале и большое количество кормовых трав. В таксономии и номенклатуре трибы пырейных выявлены противоречия, как на уровне вида, так и на уровне рода. Путаница в таксономии всей трибы пшеницевых возникает из-за разнообразия таксономических систем классификации. Среди множества вариантов, одним из решений было объединение всех видов пырея совместно с некоторыми другими видами в один род Agropyron. Другими решениями принималось разбиение трибы на несколько отдельных родов (Lve, 1984). В XVIII-XX веках таксономия пшеницевых основывалась на морфологических и географических исследованиях, таким образом, два филогенетических похожих вида могли быть отнесены в разные рода, так как произрастая в разных средах, они могут морфологически отличаться друг от друга .

Следовательно, таксономия, основанная лишь на морфологическом анализе, не может избежать ошибок в классификации. Kihara (1930) и Невский (1933) одними из первых предложил цитогенетический метод в качестве основы для изучения филогенетических взаимоотношений между видами и родами высших растений. Большой вклад в основные знания геномной конституции трибы Triticeae внесли Dewey и Holmgren (1962), проведя многолетние цитогенетические исследования многолетних трав растений этой группы .

Эти достижения создали благоприятную среду для разработки системы таксономической классификации пшеницевых и побудили Lve (1984) предложить концепцию, основанную на геномном подходе. Основа предложенной концепции заключается в том, что каждый геном или комбинация из нескольких геномов должны стать базой для определения рода. Геномный анализ идентификации геномов получил широкое признание в качестве метода исследования полиплоидов и их родословной. Однако некоторые виды, классифицированные Lve (1984) не исследовались цитогенетически в то время, что привело к таксономическим ошибкам. С тех пор появились новые методы анализа геномной конституции и были получены новые данные по таксономии трибы пшеницевых. Однако, не смотря на новую информацию, полученную на основе генетических исследований видов, многие ученые по сей день придерживаются классификации принятой Lve (1984) .

Традиционно виды пырея относили к роду Agropyron, однако в дальнейшем было предложено другое таксономическое деление, основанное на биологическом, морфологическом и в первую очередь генетическом подходе (Bowden et al., 1965; Hitchcock et al., 1971; Цвелев, 1976; Barkworth et al., 1983; Wang et al., 2009). Lve (1984) был выделен род Thinopyrum, включающий 20 видов, которые ранее входили в рода Agropyron, Lophopyrum и Elytrigia (Цвелев, 1976. Dewey et al., 1984). В род Thinopyrum отнесены виды, несущие геномы J и/или E, и иногда содержащие геном St (так же обозначаемый как S-геном) .

Lve (1984) и Dewey (1984) придерживались различного мнения в отношении геномов J и E, Lve (1984) для двух диплоидных видов Thinopyrum bessarabicum и Lophopyrum elongatum (Thinopyrum elongatum) использовал обозначения геномов J и E соответственно. В то время, как Dewey (1984) определял J=E и считал его основным геномом рода Thinopyrum .

По результатам анализа коньюгации хромосом при создании диплоидных и триплоидных гибридов ряд авторов поддержали вывод Dewey (1984) (Wang, 1985;Wang и Hsiao, 1989) В настоящее время общепринято обозначения геномов J и Е, как различных версии одного и того же базового генома. Но некоторые авторы предпочитают использовать обозначение J геном (Chen et al.,1998), в то время как другие используют Е генома (Seberg & Frederiksen, 2001; Yen et al., 2005; Fan et al., 2007; Liu et al., 2008) .

Предположительно донором J (E) генома считаются два вида пырея Th .

elongatum и Th. bessarabicum, так как при геномной in situ гибридизации было показано, что геном J (E) связан как пыреем удлиненным, так и с пыреем бессарабским. (Moustakas et al., 1988; Chen et al., 1998) Некоторые виды рода Thinopyrum включают в себя геном St, донором которого является многолетний злак Pseudoroegneria .

Наличие S (впоследствии переименованный в St) генома Pseudoroegneria в некоторых многолетних травах было подтверждено многочисленными исследованиями (Zhang et al.,1996; Chen et al., 1998; Tang et al.,2011; Kishii et al.,2005; Mahelka et al.,2011; Wang & Jensen, 2009) .

Виды входящие в род Thinopyrum разнообразны по уровням плоидности:

диплоиды (2n = 14) - Th. bessarabicum, [Savul. and Rayss] A. Love, Th .

elongatum [Host] D. Dewey, аллотетраплоиды (2n = 28) - Th. junceiforme [Love and Love] Love, Th .

distichum [Thunb.] Love, аллогексаплоиды (2n = 42) - Th. junceum [L.] Love, Th. intermedium [Host] Barkworth and D.R. Dewey, октоплоид (2n = 56) - Th. runemarkii Love, декаплоид (2n = 70) - Th. ponticum [Podp.] Barkwarth and D.R. Dewey .

Наиболее ценными в селекции пшеницы являются два вида рода Thinopyrum .

пырей средний Th. intermedium (JJJSJSSS, 2n = 6x = 42) .

пырей понтийский Th. ponticum (JJJJJJJSJSJSJS, 2n = 10x = 70);

Эти виды используют как источники хозяйственно-ценных генов для интрогрессии их в пшеницу .

1.4.4 Филогенетика видов пырея

Изучение эволюции близкородственных видов пшеницы позволит изолировать их гены в сложных геномах. Изучение филогении так же дает возможность предсказывать локализацию и функцию любого гена, связывая данные, полученные на других родственных геномах. Так, изучение предуборочного прорастания и покоя семян у пшеницы послужило идентификации многих генов у риса, кукурузы и других культур .

Несмотря на многочисленные исследования по систематике трибы Triticeae, до сих пор не существует общего мнения в отношении филогенетики и взаимосвязи между геномами (West et al., 1988; Liu et al., 2005; Adderley, 2012). Исследователи использовали различные методы для изучения филогенетических связей между видами рода Thinopyrum .

Применялись методы изучения поведения хромосом в мейозе у межвидовых гибридов (Jauhar, 1990; Dvorak, 1981; Kimber, 1983; Dewey, 1984; Wang et al., 1991; Jauhar and Joppa, 1996), метод дифференциальной С-окраски (Hutchinson et al., 1983; Friebe et al., 1992; Jiang et al., 1993). Однако сложность интерпретации результатов заключалась в полиплоидизации и высокой скорости гибридизации. Использование геномной in situ гибридизации в исследовании взаимосвязи между геномами рода Thinopyrum стало настоящим прорывом. Данный метод был широко использован для изучения геномной структуры пырея среднего (Th. intermedium). Геномная конституция пырея среднего пережила различные толкования, начиная от строго аллогексаплоида с тремя различными геномами (Peto, 1936;

Matsumura, 1949) до сегментного аллогексаплоида с двумя тесносвязанными геномами и одним отличным (Stebbins & Pun, 1953; Dewey, 1962). Dvorak (1981) продемонстрировал, что два генома, входящие в состав пырея среднего, близки к геному E пырея удлиненного. В то же время, пырей бессарабский (Eb=J) и пырей удлиненный (Ee=E) близки между собой филогенетически, что было продемонстрировано в ряде работ. Позднее Liu и Wang (1989) показали, что третий близок геному St диплоидного вида Pseudoroegneria spicata .

Chen и соавторы (1998), основываясь на результатах GISH присвоили геномный символ JS для обозначения от 6 до 11 хромосом пырея среднего. У хромосом типа JS Th. intermedium и Th. ponticum в прицентромерной области было выявлено содержание последовательностей, гомологичных уникальным сиквенсам генома S (Zhang et al., 1996a; Chen et al., 2001). Первая группа хромосом (13-14), отнесенная к S-геному, отличалась сплошной гибридизацией сигнала по всей длине хромосомы. Вторая группа (17-21) отличалась присутствием сигнала на теломерах и была обозначена как J геном. Третья группа хромосом показывала наличие сигнала в прицентромерноей области и в ряде случаев также на теломерах. Она была отнесена к комбинированному геному JS. Вероятно, в ходе эволюции происходили многочисленные обмены участками между негомологичными хромосомами (транслокации), что привело к формированию комбинированного генома JS (Chen, 2005). Перестройки хромосом в процессе эволюции были подтверждены исследованиями хромосом пырея с помощью дифференциального C-окрашивания. Результаты окрашивания показали сильный полиморфизм в распределении С-сегментов по хромосомам у различных видов Thinopyrum (Endo and Gill, 1984; Friebe et al., 1992) .

В ходе исследований Tang и соавт. (2000) пришли к аналогичным выводам в отношении геномной структуры пырея среднего и они описали его геномный состав как 21J + 7JS +14S (Tang et al., 2000). Различные результаты исследователей по геномной конституции пырея среднего показали, что при использовании меченой ДНК пробы генома St не возможно однозначно распределить геномы J и JS на две группы по 14 хромосом (Chen et al., 1998, Kishii and Wang, 2005; Mahelka et al., 2011) .

Kishii et al. (2005) используя в качестве пробы меченую ДНК Dasypyrum villosum (V-геном), смог добиться распределения на три субгенома по 14 хромосом. Таким образом было показано, что геном V Dasypyrum villosum мог быть также привнесен в геном пырея среднего в процессе эволюции (Kishii and Wang, 2005) .

На рисунке 3 приведен геномный состав некоторых видов и взаимосвязь их геномов, построенная на основе данных цитологических и цитогенетических исследований (Kellogg et al., 1996) .

Рисунок 3. Взаимосвязь геномов трибы пшеницевых (по Kellogg et al .

, 1996). 2Х, 4Х, 6Х и 8Х – уровень плоидности таксонов

1.5 Биологическое описание дикорастущих сородичей пшеницы 1.5.1 Thinopyrum intermedium Пырей средний (Thinopyrum intermedium (Host) Barkworth & D.R .

Dewey) – многолетний корневищный верховой злак озимого типа развития .

Все растение сизо-зеленого цвета с хорошо выраженным восковым налетом .

Имеет тонкие прямые или коленчатые у основания, гладкие внизу и слегка шероховатые под колосьями стебли, высотой 40- 120 см, хорошо облиственные. Сверху листовые пластины острошероховатые, шириной 5-7 мм, часто покрыты мягкими волосками; влагалища реснитчатые по краям .

Нижние листья и листья в сухом состоянии свернутые. В фазу колошения листья составляют 40-45% веса всей надземной массы. Колос прямой, редкий, внизу часто прерывистый, не ломкий, длиной 10-20 см. Колоски сидячие, крупные, длиной 1-2 см с 3-5 цветками, расположены по двум сторонам колоса. Колосковые чешуи чаще гладкие, бывают остро шероховатые по краю, тупые. Корневая система мочковатая с короткими корневищами; корни достигают глубины 200 см. Вес 1000 семян 3-4,5 г .

относится к ветроопыляющимся и Thinopyrum intermedium самоопыляющимся растениям, размножающимся семенами .

а б Рисунок 4. Общий вид растения пырея среднего, выращенного в теплице (а) и семена пырея среднего (б) Пырей средний распространен в средней полосе, в лесостепной и степной зонах, произрастает на каменистых и мелкоземистых склонах .

Обладает рядом селекционных хозяйственно-ценных признаков, в том числе способен произрастать на с известковыми и меловыми обнажениями и выносить слабое засоление, засухоустойчив. В высушенном виде семена впадают в состояние покоя и сохраняются на корню до поздней осени, а иногда и до весны. После стравливания ранней весной хорошо отрастает, позже при стравливании или скашивании отавность слабая (http://www.agrosoft.biz/agro_travki_zlakovie2.php#b36) .

Пырей средний (Thinopyrum intermedium (Host) Barkworth & D.R .

Dewey) – многолетний корневищный верховой злак озимого типа развития .

Все растение сизо-зеленого цвета с хорошо выраженным восковым налетом .

Имеет тонкие прямые или коленчатые у основания, гладкие внизу и слегка шероховатые под колосьями стебли, высотой 40- 120 см, хорошо облиственные. Сверху листовые пластины острошероховатые, шириной 5-7 мм, часто покрыты мягкими волосками; влагалища реснитчатые по краям .

Нижние листья и листья в сухом состоянии свернутые. В фазу колошения листья составляют 40-45% веса всей надземной массы. Колос прямой, редкий, внизу часто прерывистый, не ломкий, длиной 10-20 см. Колоски сидячие, крупные, длиной 1-2 см с 3-5 цветками, расположены по двум сторонам колоса. Колосковые чешуи чаще гладкие, бывают остро шероховатые по краю, тупые. Корневая система мочковатая с короткими корневищами; корни достигают глубины 200 см. Вес 1000 семян 3-4,5 г .

Thinopyrum intermedium способен к скрещиванию с пшеницей. Такой гибрид (Х Trititrigia cziczinii Tsvel.) впервые был получен Цициным (Tsitsin,

1960) и таксономически классифицирован Цвелёвым (Tsvelev, 1973). Однако между пшеницей и пыреем по сей день не было обнаружено спонтанных гибридов естественного происхождения .

Thinopyrum intermedium широко используют в селекции пшеницы и благодаря этому в пшеницу были перенесены гены устойчивости к листовой ржавчине (Lr19, Lr38), стеблевая ржавчина (Sr44), к вирусу полосатой мозаики пшеницы (WCM), к вирусу желтой карликовости ячменя (Bdv2) и устойчивости к клещу Aceria tosichella Keifer (Tyrka and Chekowski, 2004) .

Селекционно-генетическую ценность в улучшении пшеницы имеют такие свойства пырея среднего как солеустойчивость, засухоустойчивость и многоцветковость колоса .

Согласно литературным данным, в целом в геном мягкой пшеницы от пырея среднего было интрогрессированно около 20 различных генов (Sharma et al., 1995; Fedak, 2000; Tang et al., 2000; Li and Wang, 2009) .

Thinopyrum intermedium является гексаплоидом (2n=42), его геномная конституция представлена геномами Jr(=E), Jvs и St (Kishii et al., 2005). Chen и соавторами (1998) была показана возможность идентификации отдельных геномов с помощью геномной in situ гибридизации (GISH) с использованием различных проб. Учитывая эти результаты, предполагают наличие Vподобного генома в эволюционной истории вида Th. intermedium. По результатам ПЦР анализа с использованием STS маркера специфичного V геному не было обнаружено амплификации этого фрагмента у вида Thinopyrum intermedium. Это отрицает наличие V генома у вида Thinopyrum intermedium, но позволяет предположить наличие рекомбинантного генома Jvs .

–  –  –

В настоящее время пырей понтийский (Thinopyrum ponticum) выделен в отдельный вид, хотя по устаревшей номенклатуре его относили к восточноевропейской разновидности пырея удлиненного (Thinopyrum elongatum) (Цицин, 1978) .

Многолетнее дерновинное травянистое растение без ползучих подземных побегов, высотой 50-130 см. Стебли прямые, утолщенные у основания голые, иногда мелко опушенные в районе узлов и под голосом .

Влагалища по краю реснитчатые, влагалища верхних листьев голые или опушенные, нижних листьев длинноволосистые, с торчащими белыми волосками. Листовые пластины сизо-зеленого цвета, жесткие плоские до 2 мм в ширину или свернутые вдоль. Листовые пластины вегетативных побегов и нижние стеблевые шероховатые и имеют длинные реснички по краю, верхние стеблевые листья короткие с не реснитчатыми краями .

Соцветие – колосья, 7-20 см. длиной, не ломкие, более или менее цилиндрические, густые с не гребневидным расположением колосков .

Колоски сидячие, бледно-зеленые, трехцветковые. Колосковые чешуи хрящево-кожистые, тупые, 7—11 мм длиной. Нижние цветковые чешуи в колосках безостые. Внешний вид вегетирующего растения представлен на рисунке 5 .

Рисунок 5. Растение пырея понтийского, выращенное в теплице .

Ареал произрастания преимущественно восточно-европейский, часто встречается на территории Крыма в скалистой местности. Считается эндемиком (Tabaei-Aghdaei, 2000) .

Пырей понтийский обладает комплексом хозяйственно-ценных признаков, таких как высокая продуктивность (до 5000 зерен с общим весом до 17—20 г на растение), устойчивость к ряду бактериальных и грибных болезней, устойчивостью к полеганию, к засолению и засухоустойчивостью, благодаря чему этот вид перспективен в скрещивании с пшеницей (Цицин, 1978; McDonald et al., 2001; Shen W et al., 2001). Thinopyrum ponticum достаточно легко скрещивается с мягкой пшеницей, что послужило интрогрессии ряда хотяйственно-ценных генов в геном пшеницы .

Пырей понтийский является декаплоидом (2n = 10x = 70) и его геномный состав представлен геномами J и Js (JJJJsJs)

1.6 Пшенично пырейные гибриды 1.6.1 История пшенично-пырейных гибридов Пшенично-пырейные гибриды (ППГ) искусственно созданный вид растения, полученный в результате скрещивания пырея (Thinopyrum sp.) и мягкой пшеницы (Triticum aestivum). Предпосылками для создания гибридов между пыреем и пшеницей послужила высокая степень завязываемости семян при скрещивании этих двух видов. Внимание ученых к виду пырея обусловлено его устойчивостью к ряду болезней и вредителей, к абиотическим факторам и содержанию в пырее кажественных запасных белков .

С 1930-х годов берут свое начало работы по созданию ППГ, основоположником которых был советский ученый академик Н.В. Цицин. В Главном ботаническом саду АН СССР под его руководством были разработаны методы и основы отдаленной гибридизации и впервые в мире получены гибриды между пшеницей и пыреем. При скрещивании была использована как мягкая (Triticum aestivum L., 2n = 42), так и твердая пшеница (T. durum Desf., 2n = 28). Среди видов пырея в гибридизации были использованы два вида: пырей понтийский (Agropyron elongatum (Host) Beauv. (= syn. Thinopyrum ponticum Z.-W. Liu and R.-C. Wang) 2n = 70) и пырей средний (A. glaucum (Desf. ex DC) Roem. and Schult. (= syn. Thinopyrum intermedium (Host) Barkworth and D.R. Dewey), 2n = 42). Основной задачей, поставленной Цициным, было создание морозостойких многолетних сортов пшеницы. (Цицин, 1978). Ученые из многих стран скрещивали пшеницу с различными видами пырея и было получено множество селекционных линий .

(Armstrong, 1936; Peto, 1936; Sun et al., 1981). Так, в 1940-х гг. в США проведены межродовые скрещивания между мягкой пшеницей и видами пырея и цитологический анализ полученных линий показал, что диплоидный набор хромосом варьируется от 42 до 56 (Hang et al., 2005). В Китае активная работа по созданию межродовых гибридов между пшеницей и пыреем средним (Th. intermedium) берет свое начало в 1950-х гг. Результатом работы Sun и соавт. (1981) было создание частичных амфиплоидов серии “Zhong”, получивших широкое распространение в изучении ППГ по всему миру .

Для создания ППГ используются различные методы. Первый – метод половой гибридизации, включающей в себя опыление пыльцой отцовской формы кастрированных материнских растений. При этом, в качестве материнского растения чаще всего используют пшеницу, так как в таком случае процент завязываемости семян выше. Вторым методом служит культуры тканей с предшествующей ей соматической гибридизацией .

Данный способ позволяет преодолеть барьер нескрещивемости и увеличить процент обмена участками хромосом (Cui et al., 2009). Третий способ предполагает использование культуры пыльников. При этом ускоряется процесс получение хромосомных перестроек и самоклональная изменчивость обладает более широким спектром (Sharma et al., 1999) .

В зависимости от количества пырейного хроматина в геноме полученных гибридов они подразделяются на следующие типы:

амфиплоиды – полный геном пшеницы и полный или частичный 1 .

геном пырея;

дополненные линии – полный геном пшеницы и пару 2 .

дополненных хромосом пырея;

замещенные линии – полный геном пшеницы, за исключением 3 .

одной пары хромосом, замещенной на хромосомы пырея;

транслоцированные линии – одна или несколько хромосом 4 .

пшеницы несут пшенично-пырейные транслокации;

интрогрессивные линии – одна или несколько хромосом 5 .

пшеницы несут мелкие пырейные вставки в хромосомы пшеницы .

Генетический материал пырея несет в себе как положительные (устойчивость к биотическим и абиотическим факторам, качественные запасные белки), так и отрицательные нежелательные признаки (низкая продуктивность, ломкий колос, позднее созревание и др.). Поэтому пшенично-пырейные амфиплоиды или промежуточные пшенично-пырейные гибриды (ПППГ) в первую очередь важны, как исходный селекционный материал для создания интрогрессивных линий, несущих благоприятные гены пырея при минимальном количестве «генетического мусора» .

Генетическая эрозия пшеницы привела к масштабным исследованиям по пополнения генофонда пшеницы третичным генофондом дикорастущих злаков. Работы по созданию интрогрессивных линий пшеницы, несущих фрагменты хромосом пырея не потеряли свою актуальность. (Плотникова, 2014; Давоян, 2015) В настоящее время вновь возрос интерес к многолетним пшеницам, как в России (Упелниек, 2012) так и в других странах мира, таких как США, Австралия и Италия (Cox, 2010; Turner et al., 2013; Pogna, 2014), что связано с направленностью мирового сообщества на экологическое земледелие .

Возделывание многолетней пшеницы потенциально привело бы к снижению числа обработок почвы, экономии ресурсов на однократном посеве и вспашке (Jaikumar et al., 2012). Многолетняя пшеница представляет собой пример «преобразующей технологии», имеющей ряд технологических и экономических преимуществ перед однолетними культурами: многолетняя пшеница способна снизить нагрузку на окружающую среду и способна давать стабильные урожаи на маргинальных землях (Adebiyi et al., 2015;

Lloyd, 2015) Наследование устойчивости к ряду болезней и вредителей от пырея позволило бы снизить нагрузку пестицидов на агрофитоценоз .

Способность ППГ к отрастанию, могла бы послужить благоприятным фактором при использовании растений на пастбищах для корма скоту. Кроме того в условиях изменения климата многолетние пшеницы способны переживать как низкие температуры за счет морозостойкости перенесенной от пырея и устойчивости к снежной плесени, так и засухи, благодаря развитой корневой системе (Цицин, 1978; Snapp, 2008) .

Как и в случае трибы пшеницевых из-за разнообразия таксономических систем классификации не существует единого мнения в отношении таксономии ППГ. Описывая полученные им ППГ, Н.В. Цицин относил их к новому виду октоплоидной пшеницы Triticum agropyrotriticum Cicin. (Цицин, 1978). Объединив два родовых названия Triticum и Elytrigia Н.Н Цвелев присвоил ППГ латинское название Trititrigia Tzvel., которое широко используется некоторыми исследователями и в наше время (Yan-Ming et al., 2010). Некоторые авторы использовали термин Agrotriticum, который происходит он сочетания родовых названий пырея (Agropyrum) и пшеницы (Triticum) (Yuan et al., 1997, Ruz, 2009). Иногда в литературе встречается название Tritipyrum (Triticum+Thinopyrum) (Baghizadeh and Karimzadeh, 2009;

Siahsar et al., 2010; Mirzaghaderi et al., 2010) .

1.6.2 ППГ как ценный источник морфологического разнообразия

По своим морфологическим и биологическим признакам ППГ занимают промежуточное положение между пыреем и пшеницей. Вследствие использования в гибридизации различных видов пырея, отличающихся высоким разнообразием и различий в геномном составе, ППГ проявляют высокую степень морфологического полиморфизма .

Наблюдается большое варьирование по морфологии колоса: по длине колоса от (10-27 см), по форме колоса (веретеновидная, цилиндрическая) по окраске (белый, красный), по остистости (остистый, безостый), по опушенности, по цвету зерна (белое, красное, зеленое, фиолетовое). По остистости гибридов проводят более глубокое разделение, измеряя длину остей (Рис. 6). По структуре колоса ППГ можно выделять три типа, в зависимости от степени проявления пырейных и пшеничных признаков. К первому типу принадлежат плотные и широкие (лицевая сторона шире боковой) колосья пшеничного типа, с выполненными зерновками от 40- до 80 штук на колос. Второй тип характеризуется промежуточным положением. К третьему типу относятся формы с выраженным пырейным типом колоса .

Колос рыхлый с низкой плотностью, часто ломкий, его длина превышает 20 см. Формы пырейного типа и по физиологическим признакам, таким как замедленное развитие и позднее созревание, зимостойкость и многолетность приближены к пырею. (Цицин, 1976; Упелниек,2012) Рисунок 6. Разнообразие современных форм ППГ по морфологии колоса (Упелниек, 2012) ППГ различаются по типу опыления. Так как пырей является перекрестником, а пшеница – самоопылителем, то первое поколение чаще всего проявляет промежуточный тип цветения. Упелниек и соавт. (2012) сообщает, что выведенные ими современные формы ППГ являются строгими самоопылителями .

1.6.3 ППГ как ценный источник генетического разнообразия

1.6.3.1 ППГ как источник хозяйственно-ценных признаков ППГ содержат эффективные гены устойчивости, привнесенные из генома пырея, к листовой и стеблевой ржавчине, к вирусам желтой карликовости ячменя (ВЖКЯ) и полосатой мозаики пшеницы (ВПМП), к клещу Aceria tosichella, к засухе, к засолению и другие (Friebe et al., 1996;

Fedak et al., 2000). Учеными по всему миру ведется работа по исследованию и созданию пшенично-пырейных частичных амфиплоидов несущих единичную или комплексную устойчивость. Так частичные амфиплоиды Zhong-5, МT 2, TAF 46 и Agrotana относят к перспективным источникам комплексной устойчивости к ржавчинным заболеваниям, ВЖКЯ, ВПМП и галловому клещу, переносчику ВПМП (Chen, 2005, Rumajun, 1996; Xu et al., 1994). У видов пырея Th. junceiforme (2n = 4x = 28, J1J1J2J2) и Th. elongatum (2n = 2x = 14, EE) былы выявлены гены устойчивости к фузариозу колоса (Fusarium graminearum Schwabe), устойчивость была перенесена путем гибридизации в твердую пшеницу. В пшеницу так же были перенесены гены устойчивости к листовой ржавчине. Ген Lr38 интрогрессирован из пырея среднего (Th. intermedium), гены Lr24, Lr29 и Lr19 –из пырея понтийского (Th. ponticum). (McIntosh et al. 2009). В настоящее время не прекращается поиск и перенос генов устойчивости к различным биотическим и абиотическим факторам из дикорастущих сородичей пшеницы путем гибридизации с использованием ППГ (Плотникова, 2014; Zheng et al., 2014;

Hussein et al., 2014; Richardson et al., 2014; Ochoa et al., 2015) .

Высокомолекулярные глютенины относятся к важнейшим запасным белкам зерна пшеницы и ее дикорастущих сородичей и оказывают влияние на хлебопекарные качества. Известно, что качество клейковины у пшеницы зависит от нескольких параметров, в том числе от размера, количества и состава полимеров глютенина. У мягкой пшеницы на длинных плечах 1 гомеологичной группы хромосом (1A, 1B и 1D) локализованы три локуса Glu-1, состоящих из двух сцепленных генов. В каждом из двух сцепленных генов кодируется различные субъединицы высокомолекулярных глютенинов с большей и меньшей молекулярной массой. У трех видов Aegilops (Ae .

tauschii, Ae. ventricosa и Ae. umbellulata) и у видов рода Pseudoroegneria был обнаружен и клонированы несколько аллелей локуса Glu-1. (Liu L. et al., 2002 Wan et al. 2002; Sun et al. 2006; Pistn et al. 2007; Liu S. et al. 2008). У различных видов пырея выявлено высокое содержание запасных белков в зерне, что послужило стимулом к исследованиям по изучению содержания и качества белка у пшенично-пырейных гибридов. У ряда линий соматических гибридов мягкой пшеницы и пырея понтийского (Th. ponticum) выявлено высокое содержание и высокое качество белка. Данные линии несли отличные от пшеничных субъединицы высокомолекулярных глютенинов (Zhou et al., 1994: Feng et al., 2004; Zhao et al., 2003). Промежуточные ППГ Znong, в родословную которых входит пырей средний (Th. intermedium), имеют хорошие хлебопекарные качества. При этом у гибридов Znong 1 и Zhong 2 отмечалась экспрессия глютенинов, не характерных как для родительских форм пшеницы, так и для пырея среднего (Han et al., 2004) .

1.6.3.2 Генетический полиморфизм ППГ В зависимости от вида пшеницы и пырея при создании ППГ различается геномный состав, плоидность и стабильность полученных гибридов. При гибридизации используют как мягкую (гексаплоидную, 2n=42), так и твердую (тетраплоидную, 2n=28) пшеницу. Среди видов пырея, используемых при создании ППГ, наблюдается широкое разнообразие, как морфологически, так и генетически: Th. elongatum, Th. bessarabicum (диплоиды, 2n = 14), (сегментные Th. junceiforme, Th. distichum аллотетраплоиды, 2n = 28), Th. intermedium, Th. junceum (сегментные аллогексаплоиды, 2n = 42) и Th. ponticum (сегментный аллодекаплоид) .

Гибриды, получаемые при скрещивании пшеницы и пырея, в зависимости от плоидности скрещиваемых видов, являются полными или частичными амфидиплоидами. Например, к полным амфидиплоидам, в геноме которых сохраняется уровень плоидности и пшеницы и пырея, относятся ППГ, полученные в результате гибридизации твердой пшеницы и диплоидного пырея (гексаплоид, 2n=42). (Jenkins & Mochizuki, 1957;

Baghizadeh and Karimzadeh, 2009) При скрещивании мягкой пшеницы и диплоидного вида пырея будет сформирован полный октоплоидный ППГ (2n=56) (Mujeeb-Kazi et al., 2008). Banks и соавт. (1993) осуществлялись попытки создания 84-хромосомного амфидиплоида при скрещивании мягкой пшеницы и гексаплоидного пырея Th. intermedium, однако они не увенчались успехом. К промежуточным (частичным) амфидиплоидам, в которых уменьшена плоидность одного или обоих родителей в связи с утратой части хромосом, относятся все остальные формы ППГ, полученные в результате скрещивания пшеницы с пыреем более высокого уровня плоидности. К примеру, результатом гибридизации мягкой пшеницы с гексаплоидным видом пырея будет промежуточный октоплоидный Th. intermedium амфидиплоид в геном которого предположительно будут входить 42 пшеничные хромосомы и 14 пырейных. К октоплоидным промежуточным ППГ относится обширная коллекция, созданная в ГБС РАН имени Н.В .

Цицина, состоящая из более чем 250 форм, полученная в результате скрещивания первоначальных гибридов с районированными сортами пшеницы (Упелниек, 2012). Октоплоидные ППГ из данной коллекции представляют собой частичные амфидиплоиды и несут в своём геноме 42 хромосомы пшеницы и от 10 до 16 хромосом пырея, при этом различные образцы ППГ различаются между собой комбинацией пырейных хромосом (Kroupin et al., 2011) .

Так же промежуточные гексаплоидные амфидиплоиды были получены при скрещивании полного амфидиплоида T. durum/Th. distichum с твердой пшеницей (T. durum) (Pienaar, 1990) .

1.7 Молекулярные маркеры в селекции пшеницы 1.7.1 Определение понятия «молекулярные маркеры»

Молекулярные маркеры играют важную роль в современной генетике и селекции. Молекулярно-генетические маркеры выступают в качестве универсальных инструмента исследования в различных областях, таких как селекция растений и животных, таксономия, генная инженерия, филогенетика и других (Joshi et al, 2011) .

Молекулярные маркеры представляют собой маркеры, анализируемые на уровне макромолекул: дезоксирибонуклеиновой кислоты (ДНК-маркеры) или белка (белковые маркеры). В качестве белковых маркеров используются изоферменты и запасные белки, с помощью которых проведено множество исследований в области популяционной генетики. Однако белковые маркеры позволяют анализировать изменения лишь в последовательностях кодирующих белок и характеризуются зависимостью от модифицирующих условий окружающей среды и от фазы развития растения (Дубина и Мухина, 2011). Только анализ непосредственно ДНК или РНК позволяет дать устойчивые характеристики растения для маркирования хозяйственноценных признаков и генов, идентификации генотипов и регистрации сортов, не подверженные влиянию окружающей среды (Хавкин, 2003). В связи с накопленным положительным опытом применения молекулярногенетических маркеров или ДНК-маркеров они заняли лидирующие позиции в решении множества задач генетики и селекции. ДНК-маркеры характеризуются сцеплением с геном или участком генома, которые отвечают за определенный признак организма (Хлесткина, 2013) .

1.7.2 Создание молекулярных маркеров .

Традиционная селекция растений предусматривает использование морфологических и фенотипических маркеров идентификации и отбора важных агрономических признаков. Однако стремление исследователей к более быстрой и точной интрогрессии желательных признаков привело к созданию молекулярных маркеров и использованию их в селекционных программах (Kobiljski et al., 2007). После появления RFLP-маркеров (restriction fragment length polymorphism), ряд других маркеров, таких как RAPD (random amplified polymorphic DNA), AFLP (amplification fragments length polymorphism), STS (sequence-tagged sites), SSR (simple sequence repeats) и другие были введены в течение последних тридцати лет в различные селекционные программы .

Преимущество классической оценки фенотипического разнообразия заключается в прямой оценке хозяйственно-ценных признаков. Однако, в отличие от морфологических признаков молекулярные маркеры не подвержены влиянию окружающей среды, что является преимуществом в селекции фенотипически схожих признаков, контролируемых различными генами (Календарь 2002, Jonah, 2011) .

В начале века теоретическое обоснование использования XX молекулярных маркеров задолго до их практического применения дал А.С .

Серебровский (Зиновьева и др., 2008). Молекулярно-генетические маркеры наследуются по Менделевским законам и подчиняются законам сегрегации и независимого наследования .

1.7.3 Применение молекулярных маркеров в селекции растений Быстрое развитие молекулярной биологии и геномных исследований привело к использованию молекулярных маркеров в селекции растений .

Существует ряд причин, обосновывающих применение молекулярных маркеров в селекции растений. Так, при исследовании признаков зависимых от конкретных условий окружающей среды или стадий развития, использование молекулярных маркеров ускоряет процесс селекции благодаря обнаружению наличия гена задолго до его фенотипического проявления .

Целевые гены в расщепляющейся популяции могут быть идентифицированы с помощью ДНК-маркеров, что позволяет в разы ускорить традиционные селекционные программы Селекция с (Thottappilly et al, 2000) .

использованием молекулярных маркеров (marker-assisted selection - MAS) так же приводит к ускорению трансгрессии ценных генов и локусов количественного признака (Хавкин, 2003). Кроме того, молекулярные маркеры позволяют ускорить процесс сбора пирамиды генов и их интрогрессии, благодаря одновременному соединению в генотипе множественных аллелей отвечающих за одно фенотипическое проявление признака. Осуществление данного процесса в традиционной селекции является чрезвычайно трудоемким и занимает многие года (Xu, 2008). В числе достоинств применения молекулярных маркеров в селекции растений – снижение затрат на многолетние полевые опыты и масштабные исследования фенотипических проявлений признака .

1.7.4 Классификация молекулярно-генетических маркеров К молекулярно-генетическим маркерам, широко используемым в MAS селекции, относятся RAPD, SCAR, SSR, STS, CAPS и другие маркеры .

На основе метода ПЦР созданы десятки маркерных систем. Процесс использования маркеров, основанных на ПЦР, включает в себя использование двух и более олигонуклеотидных праймеров (4-20 пн), которые фланкируют целевой фрагмент. Среди ДНК-маркеров присутствует разделение на мультилокусные, наследуемые по доминантному типу, и монолокусные, наследуемые по кодоминантному (Хлесткина, 2013) .

Первый ПЦР-маркер, основанный на методе случайно амплифицированной полиморфной ДНК (RAPD-маркеры (random amplified polymorphic DNA)) относится к мультилокусным маркерам. В качестве RAPD-маркера используется праймер с произвольной последовательностью, в результате чего амплифицированные последовательности используют для изучения полиморфизма среди различных культур. На основе RAPDмаркеров, путем клонирования и секвенирования фрагментов конструируют праймеры позволяющие амплифицировать определенные участки генома (SCAR-маркер (sequence characterized amplified region)). SCAR-маркеры используются для идентификации отдельных хромосом при межвидовых интрогрессиях (Hernandez et al. 1999). Недостатком RAPD и SCAR-маркеров могут амплифицироваться как с последовательности не самого гена, так и с участков сцепленных с геном. Gupta et al. (2006) были разработаны молекулярные SCAR-маркеры на гены Lr19 и Lr24, интрогрессированные в пшеницу из генома пырея понтийского .

К монолокусным маркерам, основанным на методе ПЦР, относятся микросателитные маркеры (SSR-маркер (simple sequence repeats)) базирующиеся на простых повторяющихся последовательностях. Данный тип маркеров подходит для картирования генов. Например, Ming-Shan et al .

(2004), Guo et al. (2015), Li et al. (2015) и Shen et al. (2015) были картированы геномы пырея в интрогрессивных линиях пшеницы. Недостатком данных праймеров являтся то, что они часто не связаны с самим геном и их можно использовать лишь на конкретных расщепляющихся популяциях .

Другим монолокусным молекулярным маркером являются последовательности характеризующие локус (STS-маркеры (sequence tagget site)). STS-маркеры это короткие нуклеотидные последовательности (200-500 пн), характеризующиеся своей уникальностью, у которых известна последовательность фланкирующих праймеров. Наиболее часто их используют для создания физических и генетических карт, для выявления целевых последовательностей в рекомбинантных клонах и генномодифицированных организмах (Schachermayr et al., 1994). STS-маркеры отличаются высокой надежностью, быстротой использования и экономичностью. Данный вид маркеров относятся к функциональным маркерам, разработанным непосредственно на ген или на область, сцепленную с геном. Ряд исследований посвящено разработке и использованию STS-маркеров для детекции пырейных генов в пшеничном геноме (Prins et al., 2001; Chen et al., 2007; Zang 2008 et al., 2008; Gennaro et al., 2009) На основе STS-маркера и известной нуклеотидной последовательности гена разрабатывают функциональный маркер, путем гидролиза эндонуклеазами рестрикции получают полиморфизм рестриционных фрагментов амплифицированной ДНК (CAPS-маркер (Cleaved Amplified Polymorphic Sequences). CAPS-маркер позволяет идентифицировать больший полиморфизм. Li et al. (2007), были разработаны CAPS-маркеры для идентификации гена устойчивости желтой карликовости ячменя (BYDV) интрогрессированного в пшеницу с Е(J)-геномом пырея .

1.7.5 Молекулярные маркеры гена Viviparous-1 мягкой пшеницы

В структуре гомеолога TaVp-B1 был выявлен полиморфизм среди аллельных вариантов. Так, аллельVp-1Bb в интроне III имеет инсерцию 193 пн. А аллель Vp-1Bc в регионе этого же интрона содержит делецию 83 пн .

Инсерция имеет большую степень гомологии к ретротранспозону ячменя gypsy/Ty3. А нуклеотидная последовательность, попадающая в область делеции, показывает гомологию к ретратранспозону риса. В начале делеции в положении 5` находится пара нуклеотидов - GC, а в конце делеции, в положении 3`- AG, следовательно, эта делеция могла работать как интрон (Liuling et al., 2000; Fedorov et al., 2003) .

Наличие этих инсерций и делеций позволило разработать кодоминантный STS маркер Vp1B3 (Vp1B3F – 5’TGCTCCTTTCCCAATTGG-3’; Vp1B3R – 5’-ACCCTCCTGCAGCTCATTGна аллели Vp-1B гена (Yang et al., 2007). Данные праймеры позволяют амплифицировать три различных по размеру фрагмента: 652 пн от Vp-1Ba, 845 пн от Vp-1Bb или 569 пн от Vp-1Bc фрагмент, ассоциированный с устойчивостью. В результате секвенирования ПЦР-продукта с генспецефичного маркера Vp-1b2 (F – 5’-TGCTCCTTTCCCAATTGG-3’(Yang et al., 2007); R – 5’-TGCTTCTCTTCTCTCACCAGTG-3) Chang и соавторы (2009) выявили новый аллель Vp-1Bf. При амплификации с использованием праймеров Vp-1b2 визуализируется два фрагмента: 532 пн от Vp-1Ba и 616 пн от Vp-1Bf. В результате выравнивания с аллелем Vp-1Ba было показано, наличие инсерции в 193 пн и делеции 109 пн. Аллель Vp-1Bf был выявлен у сорта Wanxianbaimaizi обладающего высокими показателями покоя семян (Chang et al., 2009) .

При анализе европейских сортов гексаплоидной пшеницы был выявлен и новый аллель Vp-1Bd, имеющий делецию 25 пн в той же области, что и .

Как известно интроны не несут информации о последовательности аминокислот, однако, радом исследований было показано, что они участвуют в регуляции экспрессии генов (Erkkila and Ahokas, 2001; Fiume et al., 2004; Fu et al., 2005; Sjakste and Zhuk, 2006). Однако связь между новым аллелем VpBd и устойчивостью к предуборочному прорастанию не была доказана (Xia et al., 2009). Yang и другими (2007) было показано, что 90% сортов пшеницы, устойчивой к предуборочному прорастании содержали аллели Vp-1Bb и VpBc, в то время, как у 90% неустойчивых сортов было выявлено наличие аллеля Vp-1Ba .

Таким образом, анализируя литературные данные, выявлена важность исследования генов Vp-1 дикорастущих сородичей пшеницы. Следует отметить, что у видов пырея, широко используемых в селекции пшеницы, ранее структурно-функциональные особенности генов Vp-1 не были изучены .

2 ГЛАВА 2 МАТЕРИАЛЫ И МЕТОДЫ

Экспериментальная работа выполнена в 2012-2016 годах в Центре молекулярной биотехнологии ФГБОУ ВО РГАУ-МСХА имени К.А .

Тимирязева .

2.1 Растительный материал В качестве растительного материала нами были использованы образцы растений пяти видов дикорастущих злаковых, представленные в таблице 1 .

Таблица 1 Дикорастущие сородичи пшеницы, использованный в диссертационной работе

–  –  –

Также в исследовании была использована коллекция пшеничнопырейных гибридов (ППГ), состоящая из 102 образцов, созданных в Отделе отдаленной гибридизации ГБС РАН им. Н.В. Цицина (предоставленные В.П .

Упелниеком, В.И. Беловым): Отрастающая 38, 1807 безостая, М169, М3202, 3П26/1, 12, 33, 47, 49, 90, 150 бел, 150 крас, 166, 168, 186, 192, 237, 243, 249, 548, 1375, 1382, 1416 безостая, 1416 остистая, 1432, 1451, 1508, 1512, 1514, 1533, 1546, 1626, 1646, 1654, 1665 хв, 1665 ост, 1674, 1689, 1690, 1692, 1735, 1737, 1744, 1745, 1748, 1754, 1755, 1761, 1765 бел, 1765 кр, 1770, 1772, 1774, 1777, 1779, 1780, 1783, 1784, 1788, 1792, 1795 слабо остистая, 1795 сильно остистая, 1803, 1804 красный колос, 1804 белый колос, 1805, 1807 остистая, 1807 хвост, 1832, 1842, 1844, 1857, 1861 безостая, 1861 хвост, 1865 бел, 1865 бел кр,1865 кр, 1866, 1868, 1869, 1870 остистая, 1870 безостая, 1872, 1874, 1876, 1877, 1878, 1879, 4082/2, 2087, 5542/2, 3215, 3240, 4015, 4023, 4044, 4056, 4061, 5156, 5795 и сорта мягкой пшеницы (Иволга, Московская 39 и Тулайковская 100) .

2.2 Методы исследования 2.2.1 Выделение ДНК из растительного материала

ДНК выделяли из молодых листьев и корешков по методу Bernatzky и Tanksley (1986) с некоторыми модификациями .

Семена ППГ и мягкой пшеницы замачивали водой в чашках Петри с фильтровальной бумагой и оставляли в термостате при температуре 240С .

Отбирали проростки длиной 1,5-2,5 см. У образцов дикорастущих сородичей пшеницы отбирали молодые листья с вегетирующих растений. Молодые проростки или листья помещали в 1,5 или 2 мл пробирки типа Эппендорф .

Далее растительный материал в пробирках на холоде растирали в буфере для экстракции (0.35 М сорбитол, 100 мМ трис-HCl, 5 мМ ЭДТА, рН 7) .

Центрифугировали 10 мин при 14000 об/мин. Сливали надосадочную жидкость, добавляли буфер для экстракции, интенсивно встряхивали .

Лизировали при 65С в буфере для лизиса (1 М трис-HCl pH 7,5, 0,5 ЭДТА, 5 М NaCl, 2% CTAB) с добавлением 5 % саркосила. После лизиса, производили очистку смесью хлороформ-изоамилового спирта (24:1) и центрифугировали при 14000 об/мин в течение 10 мин. Отбирали надосадочную жидкость и осаждали ДНК в одном объеме изопропанола. Центрифугировали при 14000 об/мин в течение 10 мин, осадок высушивали и растворяли в MQ-воде .

Размер выделенной ДНК и степень загрязненности РНК оценивали методом электрофореза в 1,5% агарозном геле. Концентрацию ДНК определяли c помощью спектрофотометра NanoDrop 1000 (ThermoScientific) .

–  –  –

Полученные ПЦР продукты были лигированы и клонированы. В случае с частью II ген Vp-1 (1,2 экзоны, 1,2 интроны) ПЦР-продукт целевого размера был вырезан и элюирован из 1,1% агарозного геля с помощью набора Isolate II Genomic DNA Kit (SkyGen). В случае с высококонсервативной частью I (экзон 1) гена Vp-1 было произведено секвенирование непосредственно очищенного ПЦР-продукта .

Клонирование нуклеотидных последовательностей гена Vp-1 дикорастущих сородичей пшеницы Лигирование амплифицированной ДНК осуществлялось в вектор pGEM®-T Easy. Непосредственно лигирование проводили в следующей смеси компонентов: 2 лигазный буфер для T4 ДНК-лигазы – 5 мкл;

pGEM®-T Easy Vector (50 нг) – 1 мкл; ПЦР-продукт – X мкл, T4 ДНК-лигаза (3 Weiss ед/мкл) – 1 мкл. Очищенной водой доводили до конечного объема в 10мкл .

Для каждой реакции лигирования рассчитывали оптимальную массу добавляемого ПЦР продукта по формуле:

Лигирование осуществлялось при +4С в течение 16 ч .

В качестве бактерии для молекулярного клонирования нами был выбран бактериальный штамм DH10B Escherichia coli, источник штамма:

Life Technologies. Трансформацию в бактериальную клетку осуществляли методом холодового шока. Культуру клеток, прошедшую трансформацию, по 100 мкм рассевали в чашки Петри с твердой LB-средой с ампицилином, IPTG и X-Gal. Далее чашки Петри инкубировались при +37С в течение ночи и на следующий день осуществлялся отбор рекомбинантных клонов с помощью бело-голубой селекции. Дальнейшим отбор для секвенирования полученных клонов осуществлялся с помощью ПЦР. В качестве праймеров использовались универсальные праймеры М13, фланкирующие область вставки. Таким образом, при электрофорезе отбирали клоны, несущие вставки целевого размера, а также выделяли ячейки в планшетах, которые

–  –  –

2.2.3 Секвенирование и анализ частичных последовательностей гена Vp-1 Секвенирование выделенных нами плазмид с клонированными частичными последовательностями или секвенирование ПЦР-продукта частичных последовательностей гена Vp-1 различных видов дикорастущих злаков осуществлялась на приборе «3130 Genetic Analyzer» .

Проведение реакции секвенирования осуществляли с использованием коммерческого набора реагентов для секвенирования ДНК Big Dye Terminator v3.1 Sequencing RR-100 и по протоколам, рекомендуемым производителями .

Реакционная смесь для секвенирования включала следующие объемы компонентов, в расчете на одну пробирку: оптимизированный буфер для Big Dye Terminator v3.1 - 2 l; Big Dye Terminator v3.1 - 4 l; Праймер - 3 pmol;

H2O до объема 19 l .

В качестве праймеров для секвенирования использовали праймеры M13 F/R на область полилинкеров плазмиды. При секвенировании непосредственно ПЦР-продукта были использованы праймеры, участвовавшие в амплификации ПЦР-продукта. Каждая из выделенных плазмид и каждый ПЦР-продукт секвенировались с обоих концов. Смесь компонентов перемешивалась и центрифугировалась на вортексе .

Общий объем реакционной смеси 20 мкм, в каждую пробирку типа Эппендорф объемом 0,2 мл вносилось по 19 мкл приготовленной смеси компонентов и по 1 мкл выделенной нами плазмидной ДНК .

Полимеразная цепная реакция под секвенирование проводилась в амплификаторе Tetrad 2 Peltier Thermal Cycler (Bio-Rad, США) по профилю:

денатурация (96°C, 10 сек.), отжиг (58°C, 5 сек.) и элонгация (60°C, 4 мин) .

В каждую центрифужную пробирку объемом 1,5 мл добавляли по 50 мкл охлажденного 96% этилового спирта. Далее в микропробирки объемом 0,2 мл с реакционной смесью добавляется 2 мкл 0,125М ЭДТА и 2 мкл 3М ацетата натрия. Реакционная смесь с ацетатом натрия из микропробирок переносилась в пробирки с этиловым спиртом и перемешивались на вортексе. Пробы инкубировались в морозильной камере при минус 20°С в течение 45 минут, затем центрифугировались в течение 15—20 мин. при 12000 об./мин. при 4°С. Затем надосадочная жидкость тщательно удалялась (отбиралась с помощью пипетки). К осадку добавлялось 70 мкл охлажденного 80% этилового спирта. Пробы центрифугировались в течение 10 мин. при 12000 об/мин при 4°С, надосадочная жидкость тщательно удалялась (отбиралась с помощью пипетки). Осадок высушивался при 41°С в настольном термостате до полного высыхания. После высушивания к осадку добавлялось 10 мкл формамида, перемешивалось на вортексе и инкубировалось 5—10 мин. при 41°С или 20–30 мин. при комнатной температуре для полного растворения осадка .

Секвенирование осуществляли на приборе 3130 Genetic Analyzer на капиллярах 50 см, с калибровкой прибора по матрице для работы со смесью Big Dye Terminator v3.1, на полимере РОР6 и по стандартным протоколам секвенирования на данном приборе .

Пробы, растворенные в 10 мкл формамида, переносили из пробирок в 96-луночный планшет (96-Well Plate Base, Applied Biosystems, США) и закрывали специальной септой и держателем (96-Well Plate Septa и 96-Well Plate Retainer, Applied Biosystems, США). Денатурировали смесь в амплификаторе при 95 °С в течение 2 минут при открытой крышке, затем планшет загружался в сиквенатор .

После завершения электрофоретического разделения продуктов предварительные данные, собранные программой Data Collection, подвергали анализу с помощью специализированных программ .

На первом этапе анализа использовались программы Sequencing Analysis 5.2 и Chromas Lite, которые позволяли посмотреть первичные данные и оценить ряд параметров, таких как общий уровень сигнала по каждому из четырех нуклеотидов (высота пиков), уровень фонового сигнала, степень достоверности идентификации каждого нуклеотида в сиквенсе .

На втором этапе анализа использовались программы GenDoc, Blast, Lasergene 7.0 которые позволяют обрабатывать полученные данные, сравнивать их с последовательностями из базы NCBI, а так же собирать перекрывающиеся фрагменты частей гена в один

2.2.4 Оценка коллекции ППГ на устойчивость к предуборочному прорастанию

Уровень покоя семян оценивали по динамике их прорастания в чашках Петри в течение 7 дней с последующим расчётом индекса прорастания по

Walker- Simmons (1987):

ИП=(7xn1+6xn2+…+1xn7)/7*общее число зерен

– Где n1, n2, …, n7 - число семян проросших на первый, второй, и последующее дни до седьмого дня, соответственно; N – общее число жизнеспособных зерен; D – общее число дней испытания (Walker-Simmons, 1988). Анализировалось по 50 семян каждого образца, в четырехкратной повторности. Индекс прорастания варьирует в пределах от 0 до 1, при этом, чем более глубокий покой имеют семена, тем ниже значение данного индекса .

Оценку образцов на устойчивость к прорастанию в колосе проводили во влажной камере на стеллажах обитых полиэтиленовой пленкой. Колосья, убранные в фазу полной спелости, предварительно замачивали в дистиллированной воде в течение 1 часа и размещали на стеллажи в вертикальном положении в снопиках по 5 колосьев каждого образца .

Снопики, помещенные в камеру, 3 раза в день опрыскивались водой в течение 5 минут. Визуальный подсчет явно проросших зерен проводили на 3 и 7 дни провокации .

В дополнение оценивалась морфология колоса - остистость, цвет колосковых чешуй, цвет зерновок и трудность обмолота .

Интенсивность окраски зерна определяли по стандартной методике замачиванием в 5% растворе NaOH (Пыльнев и др. 2005) .

2.2.5 Статистический анализ данных .

Наличие связи количественных признаков с молекулярными маркерами устанавливалось методом дисперсионного анализа. Для расчётов использовались данные только гомозиготных по маркеру растений. Связь качественных признаков и признаков, оцениваемых в баллах, с молекулярными маркерами устанавливалась на основе точного теста Фишера. Связь количественных признаков между собой оценивалась методом корреляционного анализа. Использовались пакеты программ Statistica 7, MS Excel 2000 .

3 ГЛАВА 3 РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Изучение структуры и функционирования генов Vp-1 у дикорастущих сородичей пшеницы с возможностью дальнейшего привнесения их в геном культурных сортов поможет расширить спектр толерантности к предуборочному прорастанию, а так же позволит понять принципы регуляции процесса прорастания. При выборе объектов исследования среди видов трибы пшеницевых учитывался ряд факторов. Во-первых, отобранный вид должен обладать рядом хозяйственно-ценных признаков и нести гены, детерминирующие устойчивость к неблагоприятным абиотическим и биотическим факторам внешней среды. Это условие обусловлено тем, что с экономической точки зрения более оправдана интрогрессия комплекса генов с различными хозяйственно-ценными признаками, в том числе с устойчивостью к предуборочному прорастанию. Во-вторых, у вида желательно наличие уже созданных гибридов с культурными злаками. Таким образом, становится возможным изучение влияния гена Vp-1 на устойчивость к предуборочному прорастанию в присутствие генома пшеницы и перенос генов-гомологов непосредственно в пшеницу, используя данные гибриды в качестве селекционного «мостика». В качестве объектов исследования мы использовали два аллополиплоидных вида пырея: пырей средний (Th .

intermedium) и пырей понтийский (Th. ponticum). Эти виды были использованы при создании обширной коллекции пшенично-пырейных гибридов, созданных в отделе отдаленной гибридизации ГБС РАН имени Цицина. Кроме того, данные виды активно используются в селекции пшеницы (Friebe et al., 1996; Chen, 2005; Sibikeev et al., 2005; Diaz et al., 2009;

Wang & Jensen, 2009; Wang, 2011). До данного исследования нуклеотидные последовательности гена Vp-1 у этих видов были неизвестны .

Пырей средний и пырей понтийский являются аллополиплоидами и могут нести большое количество аллельных вариантов. Thinopyrum intermedium (JrJvsSt, 2n = 6x = 42) является гексаплоидом, и содержит в своем геноме 3 субгенома. Таким образом, теоретически он может содержать три различающихся гомеологичных гена Viviparous-1 и шесть аллельных вариантов одновременно .

Thinopyrum ponticum – декаплоид (JSJSJJJ, 2n = 10x = 70). Теоретически может содержать до двадцати аллелей гена Vp-1 одновременно .

Одними из вероятных доноров субгеномов пырея среднего и пырея понтийского являются диплоидные виды: Thinopyrum bessarabicum (Jb), Pseudoroegneria spicata (St) и Dasypirum villosum (V) (Chen, 2005; Kishii et al., 2005; Liu et al., 2009). В связи с чем, для более разностороннего изучения ортологов гена Vp-1 Th. intermedium и Th. ponticum нами проведено клонирование частичных последовательностей других видов дикорастущих сородичей пшеницы: Thinopyrum bessarabicum (JbJb, 2n = 2x = 14), Pseudoroegneria spicata (StSt 2n = 2x = 14) и Dasypirum villosum (VV, 2n = 2x = 14) .

3.1 Секвенирование частичных последовательностей гена Vp-1 у дикорастущих сородичей пшеницы Ортологи Vp-1 гена были идентифицированы у арабидопсиса, мягкой пшеницы, кукурузы, риса, овсюга и банана (Cao et al., 1992; Shen et al., 2001;

Utsugi et al., 2006; et al., Kushiro et al., 2004; Yang et al., 2007). Большое внимание уделялось изучению гена Vp-1 мягкой пшеницы (Yang et al., 2007;

Sun et al., 2011). Были получены различные аллельные варианты гена, построена его полноразмерная структура, изучен сплайсинг и проведены исследования по его функционированию и регуляторным функциям .

Для секвенирования и поиска новых аллельных вариантов генов Vp-1 на основе последовательностей трех гомологов Vp-1A, Vp-1B и Vp-1D мягкой пшеницы Yang с соавторами (2007) и Sun с соавторами (2011) был разработан набор ген-специфичных праймеров. Разработанные праймеры позволяли секвенировать полноразмерный ген Vp-1, предварительно разбив его на 4 части. Часть I гена Vp-1 включает в себя часть первого экзона, Часть II гена Vp-1 содержит часть первого, второй и третий экзоны и первый, второй и часть третьего интроны. Часть III гена Vp-1 – четвертый и пятый экзоны и часть третьего, четвертый и часть пятого интроны. Часть VI гена Vp-1 – часть пятого и шестой экзоны и пятый интрон .

Для секвенирования гена Vp-1 у дикорастущих сородичей пшеницы нами использовался схожий подход – разделение гена на 4 части, и амплификация, клонирование, секвенировение и анализ каждой части гена в отдельности. Как предполагается, данный подход позволяет выявить и охватить разнообразие максимального числа гаплотипов гена Vp-1 у и что ввиду их Thinopyrum intermedium Thinopyrum ponticum, аллополиплоидной природы является очень актуальным вопросом .

Общая схема разделение гена на части и праймеры используемые в нашей работе представлены на Рисунке 7 .

Рисунок 7. Схематичное изображение гена Vp-1 .

Праймеры Vp1A3F/R на часть I; праймеры Vp1A1F,Vp1B1R и Th_allR* на часть II; праймеры Vp1A2F и VpPsevR*, VpPont1R*, VpPont4R*, VpBessR*, VpDasBR* на часть III;

праймерыVp1BB4F/R на часть IV. * - обозначены подобранные нами ген-специфичные праймеры для изучаемых нами видов дикорастущих сородичей пшеницы. Э1-6 – схематическое расположение экзонов гена Vp-1. И1-5 – схематическое расположение интронов гена Vp-1 .

Работа по секвенированию по каждой выделенной нами части гена Vpвсего 4 части гена) состояла из следующих этапов:

Этап 1. Подбор на основе литературных данных и апробация праймеров для амплификации выделяемых нами отдельных частей гена у Th .

intermedium и Th. ponticum. Подбор праймеров на основе сиквенсов получаемых нами непосредственно в ходе работы .

Праймеры, использованные в работе указаны на рисунке 7 .

Этап 2. Клонирование, трансформация и секвенирование амплифицированных частичных последовательностей гена Vp-1 дикорастущих сородичей (раздел 3 .

2.2) Этап 3.

Сравнительный анализ полученных нуклеотидных последовательностей гаплотипов по каждой части гена (разделы:

3.2.2.1; 3.2.2.2; 3.2.2.3; 3.2.2.4) .

Этап 4. Соединение нуклеотидных последовательностей, относящихся к «часть I», «часть II», «часть III» и «часть IV» гена Vp-1 у Th .

intermedium и Th. ponticum в полноразмерный ген на основании анализа перекрывающихся нуклеотидных последовательностей и филогенетического анализа (раздел 3.3) 3.1.1 Клонирование гаплотипов гена Vp-1 дикорастущих сородичей пшеницы В результате проведения работ по лигированию амплифицированной ДНК в вектор, клонированию полученных конструкций в бактериальных клетках, отбору клонов с помощью ПЦР с праймерами М13, размножение и криоконсервации в общей сложности было проанализировано более 1000 клонов .

При секвенировании клонированных фрагментов ДНК нами так же учитывалась возможность, что при амплификации с праймерами участвующими в нашей работе могли амплифицироваться фрагменты ДНК и с других транскрипционных факторов. И вероятность этого тем более велика, из-за того, что различные транскрипционные факторы имеют много общих консервативных последовательностей. Таким образом, клонированные нами последовательности могли относиться и к другим генам помимо гена Vp-1 .

В связи со всем вышеизложенным тотальное секвенирование всех полученных нами клонов было бы нецелесообразно.

Поэтому мы использовали следующую схему работы:

1. С максимальной точностью определяли размеры клонированных последовательностей и разделяли их по классам в соответствии с размерами .

2. Секвенировали по два клона из каждого класса только с одного праймера M13F .

3. С помощью Blast определяли, какой из классов клонов гомологичен гену Vp-1 .

4. Секвенировали с обеих сторон клоны, относящие к классу, по которому были получены сиквенсы гомологичные гену Vp-1. При этом в случае аллополиплоидных видов Thinopyrum intermedium и Thinopyrum ponticum секвенировали все клоны, относящиеся к искомому классу. Так же предпочтение отдавалась клонам, нуклеотидная последовательность которых приходилась на одну и ту же часть гена, но полученным с различных праймеров, для более достоверной верификации данных. В случае диплоидных видов (Pseudoroegneria spicata, Thinopyrum bessarabicum, Dasypyrum villosum) секвенировали минимум пять клонов для выявления возможных аллельных вариантов и получения консенсусного сиквенса .

Полученные нами клоны по некоторым частям гена не отличались по размеру друг от друга. Чтобы не секвенировать тотально все клоны и при этом не потерять полиморфизм по аллельным вариантам и гаплотипам мы использовали скрининг «часторежущими» рестриктазами. Для секвенирования отбирались клоны с различной картиной рестрикции. (Рис.8)

–  –  –

Рисунок 8 a) Электрофореграмма продуктов ПЦР с праймеров М13 F/R до рестрикции Th. intermedium; b) Электрофореграмма продуктов ПЦР c праймерами M13 F/R с последующей рестрикцией Msp I на Th. intermedium .

В результате на секвенирование было отобрано около 450 клонов .

–  –  –

3.1.2.1 «Часть I» экзон 1 гена Vp-1 Для амплификации «части I» гена Vp-1 Thinopyrum intermedium использовали праймеры Vp-1A3 F/R, разработанные на «часть I» Vp-1 мягкой пшеницы (Yang, 2007). После клонирования, отбора клонов с помощью белоголубой селекции и амплификации клонов на праймерах M13 было проведено секвенирование. В результате секвенирования клонов относящихся к «части I» гена Vp-1 Th. intermedium были получены шесть консенсусных нуклеотидных последовательностей размером 1229, 1235, 1250 и три последовательности по 1253 п.н .

В результате BLAST анализа в базе данных GenBank (http://blast.ncbi.nlm.nih.gov/) нуклеотидные последовательности показали высокую степень гомологии (93-95%) к генам Vp-1 различным видам трибы пшеницевых. Значение E-value = 0,0, что свидетельствует о статистической значимости гомологии полученных нуклеотидных последовательностей .

Для амплификации «части I» гена Vp-1 Thinopyrum ponticum так же, как и для пырея среднего мы использовали праймеры Vp-1A3F/R (Yang, 2007) .

После клонирования и секвенирования для «части I» гена Vp-1 Th. ponticum в общей сложности были получены пятнадцать нуклеотидных последовательностей гомологичных гену Vp-1. Полученные нуклеотидные последовательности имели размеры: восемь по 1235, две по 1244, три 1256 и одна 1259 п.н. В результате BLAST анализа все нуклеотидные последовательности показали высокую степень гомологии (93-98%) к генам Vp-1 различных видов трибы пшеницевых .

«Часть I» гена Vp-1 представлена часть первого экзона, при анализе полученных последовательностей Th. intermedium и Th. ponticum не было выявлено стоп-кодонов и сдвига рамки считывания за счет инсерций или делеций не кратных трем. Таким образом, можно предположить, что полученные нами последовательности являются частями функционирующих генов .

Для амплификации «части I» гена Vp-1 Pseudoroegneria spicata были так же использованы праймеры Vp-1A3F/R (Yang, 2007). Для «части I» гена были получены две консенсусные нуклеотидные Vp-1 Ps. spicata последовательности размером 1253 пн. В результате BLAST анализа нуклеотидные последовательности показали высокую степень гомологии (95%) к генам Vp-1 злаков .

У одной нуклеотидной последовательности pssp1.2, размером 1253 п.н., выявлен сдвиг рамки считывания в районе 192 нуклеотида из-за делеции в 2 п.н. Таким образом, данная последовательность является псевдогеном .

В итоге для «части I» гена Vp-1 были получены сиквенсы: 6 последовательностей Th. intermedium, 15 - Th. ponticum и 2 - Pseudoroegneria spicata. Выравнивание полученных последовательностей друг с другом и с тремя генами трех различных субгеномов мягкой пшеницы Vp-1 представлено на Рисунке 9 .

В целом, полученные нуклеотидные последовательности «части I» гена Vp-1 и относящиеся к экзону 1 были относительно консервативны .

Обращает на себя внимание инсерция/делеция в районе 1004 нуклеотида (рисунок 9, индел G) по которой полученные нами нуклеотидные последовательности гаплотипов на две группы с делецией в 18 п.н. (thint1.1, thpon1.1, thpon1.2, thpon1.4, thpon1.5, thpon1.6, thpon1.8, thpon1.11, thpon1.12, thpon1.14, thpon1.15) и без нее (thint1.2, thint1.3, thint1.4, thint1.5, thint1.6, thpon1.3, thpon1.7, thpon1.9, thpon1.10, thpon1.13, pssp1.1 и pssp1.2). При этом данная делеция присутствует в основном у последовательностей Th. ponticum и только у одной из последовательностей Th. intermedium. У всех генов Vp-1 мягкой пшеницы делеции нет .

Еще одна распространённая инсерция в 3 нуклеотида (рисунок 9, индел H), не вызывающая сдвиг рамки считывания и отсутствующая у генов Vp-1 T.aestivum, встречается у гаплотипов thpon1.3, thpon1.7, thpon1_10, thpon1.13 .

Большое количество однонуклеотидных замен у различных гаплотипов отмечается в регионе с 360 по 450 пн .

Так же при сравнительном анализе полученных в ходе нашей работы нуклеотидных последовательностей «части I» гена Vp-1 можно выделить следующие интересные особенности свойственные отдельным гаплотипам:

thpon1.2 – делеция 18 п .

н., отличающуюся от других делеций сдвигом на 7 п.н. в сторону 5’ конца последовательности гена Vp-1;

thpon1.1 и thpon1 .

13 – инсерция 3 пн (индел А);

thpon1.10 – ряд инсерций/делеций (3/6 пн) (индел C);

thpon1.1 и thpon1 .

13 – инсерция в 6 пн (индел B);

thpon1.9 и thint1 .

4 - делеция 3 пн (индел D);

thint1.1 – делеция 24 пн (индел E) .

Хотелось бы еще раз отметить, что «часть I» гена Vp-1 состоит только из экзона 1. Таким образом, все выявленные и описанные нами инсерции\делеции в нуклеотидных последовательностях гаплотипов дикорастущих сородичей пшеницы проявятся в аминокислотной последовательности транслируемого белка гена Vp-1. Так же обращает на себя внимание, что все выявляемые инсерции/делеции у гаплотипов Th .

intermedium и Th. ponticum были кратны трем и не приводили к сдвигу рамки считывания. А следовательно, можно предполагать различающее влияние выявленных нами гаплотипов на фенотип растения .

Рисунок 9 а Рисунок 9 в .

Рисунок 9 в. Сравнительное выравнивание полученных нами гаплотипов «части I» гена Vp-1 Th. intermedium, Th .

ponticum, Ps. spicata и T. aestium. Цветом обозначена посадка праймеров. Буквами обозначены значимые инделы .

3.1.2.2 «Часть II» 1-3 экзоны, 1-3 интроны гена Vp-1 Для амплификации «части II» гена Vp-1 Thinopyrum intermedium использовали праймеры Vp-1A1 F (=Vp-1B1 F) и Vp-1B1 R (Yang, 2007). Так же на основе полученных позже последовательностей «части III» гена Vp-1 с помощью программы Praimer3 был подобран специфичный обратный праймер Th-all R (5’ – TCCCACAGTGATGCAGTGAT - 3’). После клонирования, отбора клонов и их амплификации на праймерах M13 было проведено секвенирование. В результате секвенирования клонов относящихся к «части II» гена Vp-1 Th. intermedium были получены семь консенсусных нуклеотидных последовательностей с праймеров Vp-1A1 F (=Vp-1B1 F) и Vp-1B1 R размером 955, три по 1044, 1045 и 1048 пн. С праймеров Vp-1A1 F и Th-all R получены две последовательности длиной 1148 и 1186 .

В результате BLAST анализа все нуклеотидные последовательности показали высокую степень гомологии (92-93%) к генам Vp-1 различных видов трибы пшеницевых. Несмотря на то, что полученные нами консенсусные последовательности «части II» гена Vp-1 у Thinopyrum intermedium были более вариативны, чем последовательности «части I» гена Vp-1, все показали наибольшую степень гомологии к генам Vp-1 полученным у Triticum monococcum .

При амплификации «части II» гена Vp-1 Thinopyrum ponticum, так же как и для пырея среднего, были использованы праймеры –Vp-1A1 F (=Vp-1B1

F) и Vp-1B1 R (Yang, 2007) и подобранный нами обратный праймер Th_all R .

После клонирования и секвенирования для «части II» гена Vp-1 Th. ponticum в общей сложности были получены тринадцать нуклеотидных последовательностей. Восемь из них были получены с праймеров 1A1 F (=Vp-1B1 F) и Vp-1B1 R и имели размеры: 1023, 1029, 1044 и пять по 1045 пн .

Пять последовательностей были получены с праймеров Vp-1A3F и Th_allR и имели размеры: 1165, три по 1185 и 1187 пн. BLAST анализ нуклеотидных последовательностией показал высокую степень гомологии (91-95%) к генам Vp-1 различных видов злаковых .

Для амплификации «части II» гена Vp-1 Thinopyrum bessarabicum были использованы праймеры Vp-1A1F (=Vp-1B1 F) и Vp-1B1 R (Yang, 2007). В результате клонирования и секвенирования для «части II» гена Vp-1 Th .

были получены три консенсусные нуклеотидные bessarabicum последовательности размером по 1035 пн. В результате BLAST анализа нуклеотидные последовательности показали высокую степень гомологии (94к генам Vp-1 двум видам злаков .

У одной из девяти нуклеотидных последовательностей Th. intermedium thint2.7 обнаружен стоп-кодон 5’-TAG-3’ в районе 1251 нуклеотида (Рис.10) .

Наличие стоп-кодона может свидетельствовать о том, что данная последовательность относится к псевдогену .

Рисунок Нуклеотидная последовательность гаплотипа 10 Th .

intermedium thint2.7, с выявленным стоп-кодоном в области открытой рамки считывания .

«Часть II» гена Vp-1 представлена частью первого экзона, вторым и третьим экзонами, первым и вторым и частью третьего интронами. У полученных нами нуклеотидных последовательностей, за исключением последовательности Th. intermedium thint1.4, не было выявлено стоп-кодонов и сдвига рамки считывания, из чего следует, что данные последовательности могут быть частью функционирующих генов .

В итоге для «части II» гена Vp-1 были получены сиквенсы: 9 последовательностей Th. intermedium и 13 - Th. ponticum и 3 - Th .

bessarabicum. Выравнивание полученных последовательностей друг с другом и с тремя генами Vp-1 трех различных субгеномов мягкой пшеницы представлено на Рисунке 11 .

В целом, полученные нуклеотидные последовательности «части II»

гена Vp-1 относящиеся к части первого экзона, второму и третьему экзонам, первому и второму и частью третьего интронам, были относительно консервативны .

Во втором экзоне выявлена распространенная делеция в 3 п.н. у последовательностей Th. intermedium thint2.4, thint2.6, thint2.7, thint2.8, thint2.9, а у последовательностей Th. ponticum thpon2.3 и thpon2.6 делеция смещена на 1 нуклеотид в сторону 5’-конца (рис. 11, индел D) .

В интронах обращают на себя внимание ряд индел. В районе 665 нуклеотида наблюдается индел, делящий полученные нами нуклеотидные последовательности на три группы: имеющие делецию 6 пн, имеющие делецию 3 пн и не имеющие делецию (рис. 11, индел Е). У большинства полученных нами последовательностей имеется делеция 6 пн: thint2.1, thint2.3, thint2.5 и у Th. ponticum thpon2.1, thpon2.2, thpon2.4, thpon2.5, thpon2.7, thpon2.8, thpon2.10, thpon2.11, thpon2.12, thpon2.13. У пяти последовательностей Th. intermedium thint2.4, thint2.6, thint2.7, thint2.8 и thint2.9 имеет место делеция 3 пн. У полученных нами последовательностей thint2.2, thpon2.3, thpon2.6, thpon2.9, thbes2.1, thbes2.2, thbes2.3 и у последовательностей трех различных субгеномов мягкой пшеницы делеция отсутствует .

Еще один индел в 6 нуклеотидов делит выровненные последовательности на две группы с инсерцией (thint2.1, thint2.3, thint2.4, thint2.5, thint2.6, thint2.7, thint2.8, thint2.9, thpon2.1, thpon2.3, thpon2.4, thpon2.5, thpon2.7, thpon2.8, thpon2.9, thpon2.10, thpon2.11, thpon2.12, thpon2.13) с последовательность субгенома А и без инсерции (thint2.2, thpon2.2, thpon2.6,, thbes2.1, thbes2.2, thbes2.3) с последовательностями субгеномов B и D (рис11, индел С) .

В регионе с 835 по 855 нуклеотид выявлена серия нуклеотидных замен .

У последовательностей thint2.2 и thpon2.6 наблюдается та же картина замен, что и у последовательностей мягкой пшеницы относящихся к трем различным субгеномам .

Так же при сравнительном анализе полученных в ходе нашей работы нуклеотидных последовательностей «части II» гена Vp-1 можно выделить следующие интересные особенности свойственные отдельным гаплотипам:

thint2.3 – крупная делеция 90 пн у последовательности в первом экзоне есть (рис11, индел А) .

Эта делеция не приводит к сдвигу рамки считывания, но удаляет из первого экзона тридцать кодируемых аминокислот. Подобное изменение транслируемого белка может привести к значительным изменениям его работы .

thpon2.3 и thpon2 .

9- инсерции 4 пн в районе 450 нуклеотида (рис11, индел В) и делеция 33 пн в районе 800 нуклеотида (рис11, индел G) thint2.2 – крупная делеция 36 пн в интроне 2 (рис11, индел F) thpon2.6 – делеция 11 пн (рис11, индел H) thint2.6, thint2.7, thint2.8, thint2.9 – делеция 4 пн (рис11, индел H) .

Рисунок 11 а Рисунок 11 б Рисунок 11в. Сравнительное выравнивание полученных нами гаплотипов «части II» гена Vp-1 Th. intermedium, Th .

ponticum,Th. bessarabicum и T. aestium. Цветом обозначена посадка праймеров. Буквами обозначены значимые инделы .

Экзонная часть – черная заливка, интронная – серая заливка .

3.1.2.3 «Часть III» 3-5 экзоны, 3-5 интроны гена Vp-1 Для амплификации «части III» гена Vp-1 Thinopyrum intermedium использовали прямой праймер Vp-1A2 F (Yang, 2007) и подобранный нами обратный праймер VpPseuR. После клонирования и секвенирования отобранных клонов было получено семь консенсусных нуклеотидных последовательностей размером 882, 896, 914, 921, 1074, 1082 и 1159 пн .

BLAST анализ полученных сиквенсов показал высокую степень гомологии полученных нуклеотидных последовательностей (90-94%) к последовательностям гена Vp-1 различных видов злаков .

Для амплификации «части III» гена Vp-1 Thinopyrum ponticum использовали праймер Vp-1A2 F (Yang, 2007) и подобранные нами обратные праймеры VpPseuR, VpPont1R и VpPont4R. В результате клонирования и последующего секвенирования получены девять консенсусных нуклеотидных последовательностей относящихся к «части III» гена Vp-1 Th .

ponticum. C праймеров Vp-1A2 F и VpPseuR была получена одна нуклеотидная последовательность размером 881 пн. С праймеров Vp-1A2 F и VpPont1R получено четыре сиквенса размером 865, 870, 882, 888 пн. С праймеров Vp-1A2 F и VpPont4R было получено 4 консенсусные последовательности 879, 888, 917, 1075 пн. Полученные нуклеотидные последовательности были проанализированы с помощью BLAST и показана высокая степень их гомологии (89-94%) к последовательностям гена Vp-1 нескольких видов злаков .

Для амплификации «части III» гена Vp-1 Thinopyrum bessarabicum был использован прямой праймер Vp-1A3F (Yang, 2007) и подобранный нами специфичный для этого вида обратный праймер VpBessR. После клонирования и секвенирования были получены четыре консенсусные нуклеотидные последовательности размером 901, 910, 919 и 921 пн. В результате BLAST анализа была показана высокая степень гомологии (90к генам Vp-1 злаковых культур .

Для амплификации «части III» гена Vp-1 Pseudoroegneria был использован прямой праймер Vp-1A3F (Yang, 2007) и подобранный нами обратный праймер VpPseuR. После клонирования и секвенирования были получены две консенсусные нуклеотидные последовательности размером 903 и 1074 пн. BLAST анализ показал высокую степень гомологии (92-93%) полученных нуклеотидных последовательностей к генам Vp-1 различных видов трибы пшеницевых .

Для амплификации «части III» гена Vp-1 Dasypyrum villosum был использовал прямой праймер Vp-1A3F (Yang, 2007) и подобранные нами специфичные для данного вида обратные праймеры VpDasSR и VpDasVR .

После клонирования и секвенирования были получены две консенсусные нуклеотидные последовательности размером 957 и 899 пн. BLAST анализ показал высокую степень гомологии (89-91%) полученных нуклеотидных последовательностей к генам Vp-1 различных видов трибы пшеницевых .

«Часть III» гена Vp-1 включает в себя последовательности части 3, 4 и 5 экзонов и части 3, 4 и части 5 интронов. Данная часть гена отличается наибольшей вариативностью, за счет того что большая часть последовательности относится к интронной и включает в себя большие инделы. Нуклеотидные последовательности экзонов консервативны между собой, имеют лишь однонуклеотидные замены .

В итоге для «части III» гена Vp-1 были получены сиквенсы: 6 последовательностей Th. intermedium и 9 - Th. ponticum, 4 – Th. bessarabicum, 2 – Ps. spicata и 2 - Dasypyrum villosum. Выравнивание полученных последовательностей друг с другом и с тремя генами Vp-1 трех различных субгеномов мягкой пшеницы представлено на Рисунке 12 .

В интроне 4 обращает на себя внимание индел в 5 нуклеотидов делящий полученные сиквенсы на две части по наличию инсерции (thint3.1,thint3.4, thint3.6, thint3.7, thpon3.1, thpon3.2, thpon3.3, thpon3.5, thbes3.2, thbes3.3, dvil3.1, dvil3.2) и ее thpon3.7, thpon3.8, thpon3.9, отсутствию (thint3.2,thint3.3, thint3.5, thpon3.4, thpon3.6, thbes3.1, thbes3.4, pssp3.1). У всех генов Vp-1 мягкой пшеницы инсерция отсутствует (рис. 12, индел M) .

Обращает на себя внимание крупная инсерция в третьем интроне размером 174 пн присутствующая у нескольких полученных нами последовательностей, относящихся к разным видам: thint3.2, thint3.4, thpon3.4 и pssp3.1 (рис. 12, индел D) .

У шести последовательностей thpon3_1, thpon3_2, thpon3_7, thpon3_9, dvil3.1 и dvil3.2 в районе 363 нуклеотида имеется делеция в 8 пн (рис. 12, индел Е) .

В районе с 475 по 560 нуклеотида выявлена вариативная часть интрона 3 имеющая скопление одно- и двунуклеотидных замен, двух-, трех- и пятинуклеотидных индел встречающиеся у разных нуклеотидных последовательностей (рис 12, инделы F) .

Большое количество одно- и двунуклеотидных замен, двух-, трех- и пятинуклеотидных индел отмечается в области с 880 по 1000 нуклеотид (рис .

12, индел I) .

И в интроне 3 у последовательности Th. intermedium thint3_6 есть крупная инсерция размером 240 пн (рис12, инсерция H) .

Так же при сравнительном анализе полученных в ходе нашей работы нуклеотидных последовательностей «части III» гена Vp-1 можно выделить следующие интересные особенности свойственные отдельным гаплотипам:

thpon3.1, thpon3 .

2, thpon3.7 и dvil3.2 – инсерция 4 пн (индел А);

thpon3.9 и dvil3 .

1 – инсерция 7 пн (индел В);

thint3.3 и thbes3 .

3 – инсерция 3 пн, которая присутствует у субгеномов В и D генов мягкой пшеницы (индел J);

thin3.2, thpon3 .

4, thbes3.1, pssp3.1 и pssp3.2 -инсерция 3 пн (индел K);

thpon3.9 – инсерция 8 пн и dvil3 .

1 – инсерция 6 пн (индел L) .

Представляет интерес то, что у двух последовательностей полученных с разных видов thpon3.9 и dvil3.1 встречается большое количество одинаковых индел .

Хотелось бы отметить, что «часть III» гена Vp-1 включает части 3, 4 и 5 экзоны, на которые приходится функциональный В3 домен. Видимо, с этим связано то, что последовательности, относящиеся к экзонам, имеют лишь однонуклеотидные замены .

.

Рисунок 12 а Рисунок 12 б Рисунок 12 в Рисунок 12 г Сравнительное выравнивание полученных нами гаплотипов «части III» гена Vp-1 Th. intermedium, Th .

ponticum, Th. bessarabicum, Ps. spicata, D. villosum и T. aestium. Цветом обозначена посадка праймеров. Буквами обозначены значимые инделы. Экзонная часть – черная заливка, интронная – серая заливка .

Полученные нами нуклеотидные последовательности «части III» гена Vp-1 загружены в базу данных NCBI под номерами: KC788517.1, KC788518.1, KC788519.1, KC788520.1, KC788521.1, KC788522.1, KC788523.1, KC788524.1, KC788525.1, KC788526.1, KC788527.1, KC788528.1, KC788529.1, KC788530.1, KC788531.1, KC788532.1, KC788533.1 .

3.1.2.4 «Часть IV» 5-6 экзоны, 5-6 интроны гена Vp-1 Для амплификации «части IV» гена Vp-1 Thinopyrum intermedium использовали праймеры Vp-BB4 F/R (Yang, 2007). После клонирования было проведено секвенирование и в результате у Th. intermedium были получены шесть консенсусных нуклеотидных последовательностей размером 874, 883, 888, 890, 909 и 937 пн. В результате BLAST анализа все нуклеотидные последовательности показали высокую степень гомологии (86-90%) к генам Vp-1 различных видов трибы пшеницевых .

Для амплификации «части IV» гена Vp-1 Thinopyrum ponticum использовали праймеры Vp-BB4 F/R (Yang, 2007).В результате клонирования и секвенирования Th. ponticum были получены десять консенсусных нуклеотидных последовательности размером 872, 880, три по 883, 886, 888, 890, 902 и 1324 пн. В результате BLAST анализа все нуклеотидные последовательности показали высокую степень гомологии (85-90%) к генам Vp-1 различных видов трибы пшеницевых .

Для амплификации «части IV» гена Vp-1 Thinopyrum bessarabicum были использованы праймеры В результате Vp-1BB4F/R (Yang, 2007) .

клонирования и последующего секвенирования была получена одна консенсусная нуклеотидная последовательность размером 914 пн. В результате BLAST анализа нуклеотидная последовательность показала степень гомологии в 90% к генам Vp-1 трех видов пшеницы .

Для амплификации «части IV» гена Vp-1 Pseudoroegneria были использованы праймеры Vp-1BB4F/R (Yang, 2007). После клонирования и секвенирования была получена одна консенсусная нуклеотидная последовательность размером 883 пн. В результате BLAST анализа нуклеотидная последовательность показала степень гомологии в 88% к генам Vp-1 трех видов пшеницы .

Для амплификации «части IV» гена Vp-1 Dasypyrum villosum были использованы те же праймеры Vp-1BB4F (Yang, 2007). По результатам клонирования и секвенирования были получены две консенсусные нуклеотидные последовательности размером 866 и 1029 пн. В результате BLAST анализа нуклеотидные последовательности показали высокую степень гомологии (88-92%) к генам Vp-1 трех видов пшеницы .

«Часть IV» гена Vp-1 представлена частью пятого экзона, 6 экзоном,5 интроном и последовательностью следующей за транслируемой областью гена Vp-1. При анализе полученных последовательностей стоп-кодонов и сдвига рамки считывания выявлено не было .

В итоге для «части IV» гена Vp-1 были получены сиквенсы: 6 последовательностей Th. intermedium и 10 - Th. ponticum, 1 – Th .

bessarabicum, 1 – Ps. spicata и 2 - Dasypyrum villosum. Выравнивание полученных последовательностей друг с другом и с тремя генами Vp-1 трех различных субгеномов мягкой пшеницы представлено на Рисунке 13 .

В интроне 5 присутствует большое количество крупных инсерций у последовательностей гомологов гена Vp-1 мягкой пшеницы .

В первую очередь обращают на себя внимание инделы делящие полученные нуклеотидные последовательности на две группы: по наличиюотсутствию. В районе 260 нуклеотида выявлена делеция 20 пн, делящая нуклеотидные последовательности на две группы по наличию делеции pssp4.1) и ее отсутствию (thint4.5, thint4.6, thpon4.5, thpon4.7, thpon4.8, (thint4.1, thint4.3, thint4.4, thint4.7, thpon4.1, thpon4.2, thpon4.3, thpon4.4, При этом у нуклеотидной thpon4.6, thpon4.9, thpon4.10, thbes4.1) .

последовательности dvil4.1 в этом районе обнаружена делеция 32 пн, а у thint4.2 вставка в 4 пн (рис. 14, делеция D) .

В районе c 420 по 590 нуклеотид имеется индел 23 пн, обрамляющий инсерцию выявленную у последовательности гена A-генома мягкой пшеницы по 11-15 пн с 5’-конца и по 12-16 пн с 3’-конца (рис14, индел G). У последовательностей thint4.2, thint4.4, thint4.5, thint4.6, thpon4.5, thpon4.8, Th .

выявлена инсерция 23 пн (11 пн с 5’-конца и 12 пн с 3’-конца). У последовательностей thpon4.1 и thpon4.9 - вставка 31 пн (15 пн с 5’-конца и 16 пн с 3’-конца) (рис. 13, индел G). У нуклеотидной последовательности thpon4.4 инсерция составляет 18 пн (11 пн с 5’-конца и 7 пн с 3’ конца), а за инсерцией следует делеция в 4 пн .

Рисунок 13. Поясняющий рисунок выравнивания нуклеотидных последовательностей «части IV» гена Vp-1 в области индела G У трех нуклеотидных последовательностей thpon4.1, thpon4.2, thpon4.9 в районе 720 нуклеотида выявлены одинаковые делеции 4, 7 и 8 пн, следующие последовательно друг за другом через 1 и 6.пн соответственно (рис14, делеция I) .

Так же при сравнительном анализе полученных в ходе нашей работы нуклеотидных последовательностей «части III» гена Vp-1 можно выделить следующие интересные особенности свойственные отдельным гаплотипам:

thpon4.10 – делеция 8 пн (индел А);

thint4.3, thint4 .

4, thpon4.3 и thpon4.6– инсерция 6 пн (индел В);

thint4.3– делеция 14 пн (индел С);

thin4.4 – инсерция 35 пн (индел Е);

dvil14.2 – инсерция 44 пн (индел Е);

thpon4.3 - делеция в 8 пн (индел F);

thin4.4, thpon4 .

4, -делеция 9 пн (индел H);

thint4.2 – инсерция 3 пн (индел J);

thpon4.1 – инсерция 425 пн в нетранслируемой области следующей за 6 экзоном (индел K) .

Полученные нами нуклеотидные последовательности имели высокую степень гомологии в области экзона 5 и экзона 6, что связано с расположением функционального В3 домена. Экзон 6 заканчивается стопкодоном 5’-TGA-3’ у всех исследуемых последовательностей .

Полученные нами нуклеотидные последовательности «части IV» гена Vp-1 загружены в базу данных NCBI под номерами: KC788534.1, KC788535.1, KC788536.1, KC788537.1, KC788538.1, KC788539.1, KC788540.1, KC788541.1, KC788542.1, KC788543.1, KC788544.1, KC788545.1, KC788546.1, KC788547.1, KC788548.1, KC788549.1, KC788550.1, KC788551.1, KC788552.1, KC788553.1, KC788554.1, KC788555.1, KC788556.1, KC788557.1, KC788558.1, KC788559.1 Рисунок 14 а Рисунок 14 б Рисунок 14 в. Сравнительное выравнивание полученных нами гаплотипов «части IV» гена Vp-1 Th. intermedium, Th. ponticum, Th. bessarabicum, Ps. spicata, D. villosum и T. aestivum. Цветом обозначена посадка праймеров. Буквами обозначены значимые инделы. Экзонная часть – черная заливка, интронная – серая заливка .

3.2 Гипотетический полноразмерный ген Vp-1 дикорастущих сородичей пшеницы Для соединения между собой полученных нуклеотидных последовательностей относящихся к разным частям гена и получения гипотетической полноразмерной последовательности мы использовали два подхода. Первый основывался на филогенетическом анализе с целью кластеризации последовательностей и разнесению их по субгеномам .

Полученные нами нуклеотидные последовательности Th.intermedium и Th.ponticum кластеризовались с сиквенсами двух субгеномов St (донор этого субгенома Pseudoroegneria spicata) и J (донор Th. bessarabicum). А при анализе нуклеотидных последовательностей относящихся к «части III» гена Vp-1 две нуклеотидные последовательности Th. ponticum thpon3.7 и thpon3.9, кластеризовались совместно с последовательностями, клонированными у Dasypyrum villosum. Эти последовательности могут являться частью генов, унаследованных от общего с Dasypyrum villosum предка и относиться к геному Jvs (Рис. 15). Это служит одним из аргументов в пользу того, что возможным донором Jvs генома у пыреев был D. villosum или одна из его предковых форм (Kishii et al., 2005) .

В других частях гена Vp-1 не было выявлено последовательностей пырея, которые можно отнести к геному Jvs, так как полученные нами сиквенсы Dasypyrum villosum кластеризовались отдельно. Однако среди нуклеотидных последовательностей, относящихся к «части IV» гена последовательности Th.intermedium thint4.4, thint4.5 и thpon4.4 попали в отдельный кластер, который был наиболее близок кластеру Dasypyrum villosum .

Рисунок15. Кластеризация нуклеотидных последовательностей, относящихся к «части III» гена Vp-1. Последовательности, полученные в работе, отмечены фигурами .

Второй подход был основан на максимальном перекрытии последовательностей, относящихся к соседним частям гена между собой .

Нами проводилось выравнивание в программе GeneDoc нуклеотидных последовательностей соседних частей гена, относящиеся к одному субгеному и соединение полноразмерного гена Vp-1 производилось по полученному перекрытию (Рис. 16) .

Рисунок 16. Перекрытие нуклеотидных последовательностей Th .

ponticum thpon3.5 «части III» гена Vp-1 и thpon4.9 относящейся к «части IV»

гена Vp-1 В результате работы по соединению частичных нуклеотидных последовательностей в гипотетический полноразмерный ген Vp-1 получено четыре последовательности Th. intermedium и семь последовательностей Th .

ponticum. Две нуклеотидные последовательности пырея среднего и три последовательности пырея понтийского относятся к субгеному J (thintJ1, thintJ2, thponJ1, thponJ2 и thponJ3). И две последовательности пырея среднего и четыре последовательности пырея понтийского отнесены к субгеному St (thintSt1, thintSt2, thponSt1, thponSt2, thponSt3 и thponSt4) .

Для анализа функциональных доменов полноразмерная нуклеотидная последовательность гена была переведена в аминокислотную Vp-1 последовательность. У полученных полипептидов выявлен полиморфизм (Рис. Обращают на себя внимание аминокислотные замены, 17) .

встречающиеся у последовательностей, отнесенных к одному субгеному. Так в районе 45 аминокислоты присутствует замена 4 аминокислот у двух последовательностей Th. intermedium St1и St2 и у трех последовательностей Th. ponticum St2, St3 и St4. Эта же замена имеется у аминокислотной последовательности, относящейся к A-геному мягкой пшеницы. Имеется делеция в 6 аминокислот в районе 335 аминокислоты у пяти последовательностей отнесенных к St-геному Th. intermedium St1 и Th .

ponticum St1, St2, St3 и St4 и у одной последовательности Th. ponticum J2, отнесенной к субгеному J. У двух аминокислотных последовательностей Th .

intermedium, отнесенных к J-геному (J1и J2) в районе 260 аминокислоты выявлена делеция в 8 аминокислот .

Рисунок Выравнивание потенциальных аминокислотных 17 .

последовательностей, полученных в нашей работе, с аминокислотными последовательностями мягкой пшеницы, экспрессируемых геном Vp-1 .

Домен В2 выделен голубым цветом, домен В3 выделен зеленым цветом, сигнал ядерной локализации выделен красным цветом .

С помощью программного обеспечения cNLS Mapper был спрогнозирован сигнал ядерной локализации (NLS) HLQKKRPRVG, что свидетельствует об отношении полученных полипептидов к семейству белков – факторов транскрипции. NLS принимает участие в образовании активного ДНК-связывающего комплекса и отсутствие сигнала может привести к потере функциональной активности белка .

Область функционального домена B3 высоко консервативна, имеет единичные аминокислотные замены. В районе 2 аминокислоты замена лейцина (L) на аргинин (R) у последовательности Thint.St1; в районе 3 – лейцина (L) на пролин (P) у Thpon.St2; в районе 13 – глицина (G) на аргинин (R) у Thpon.J2; в районе 26 – глютаминовой кислоты (E) на глицин (G) у Thint.St2; в районе 27 – треонина (T) на изолейцин (I) у Thpon.J1 и Thpon.J3 .

Ранее в последовательности гена Vp-1 кукурузы, арабидопсиса, рапса, были выделен так же домен В2, в отличие от домена В3, считающиеся специфическим только для Vp-1-подобных белков. Этому домену так же приписывались свойства связанные с регуляцией покоя и прорастания семени (Hill et al., 1996; Bies-Etheve N. et al.,1999; Nakamura and Toyama, 2001).Область функционального домена В2 высококонсервативна, но имеет большее количество аминокислотных замен, чем в случае домена В3. В районе 6 аминокислоты присутствует замена пролина (Р) на аланин (А) сразу у шести аминокислотных аоследовательностей Thint.St1, Thpon.J2, Thpon.St1, В раоне 3 аминокислоты замена Thpon.St2, Thpon.St3, Thpon.St4 .

фенилаланина (F) на лейцин (L) у трех последовательностей Thint.J1, Thint.J2, Thint.St2; в районе 12 – фенилаланина (F) на серин (S); в районе 17 – глютаминовой кислоты (E) на глютамин (Q); в районе 24 – аланин (A) на аспарагиновую кислоту (D). Однако, в настоящее время домен В2 удален из базы данных, причины удаления не освещены в известных нам изданиях .

ДНК связывающий домен B3 наиболее хорошо изучен, так как относится к семейству транскрипционных факторов, играющих различную роль в развитии растений. К примеру, домен B3 непосредственно связывается с ДНК и принимает участие АБК-независимой активации промотора гена C1 кукурузы и необходим для АБК-зависимой регуляции napA в Brassica napus (Suzuki et. al., 1997; Ezcurra, 2000). Доказана роль факторов транскрипции - доменов В3 в регуляции созревания эмбриона, регуляции абсцизовой кислоты (AБК) и регуляции экспрессии генов в семени. В частности, успехи в исследовании роли домена, достигнутые за последние десяток лет, значительно расширили понимание B3-сети и ее роли в регулировании семенного периода развития растения в вегетативный период (Suzuki and McCarty, 2008; Roschzttardtz et al., 2009; Guo et al., 2013;

Grimault et al., 2015). Эти исследования подчеркивают важнейшую роль B3сети в регуляции AБК, гиббереллиновой кислоты (ГК), биосинтезе ауксина, обмене веществ и сигнальных путях инициации прорастания .

–  –  –

При выборе модели эволюции сиквенсов (models of sequence evolution) (Frati et al., 1997; Sullivan et al., 1997; Swofford et al., 1996) из 24 доступных моделей наименьшее значение BIC = 15350.712 показала модель «Kimura 2parameter» с гамма-распределением, соответственно расчет филогенетического дерева шел при данных параметрах. В качестве аутгруппы была использована последовательность гена Vp-1 Brassica oleracea .

При рассмотрении данного филогенетического древа можно выделить девять клад. Последовательности гена, относящиеся к A-геному мягкой пшеницы попадают в отдельный кластер, совместно с T. monococcum .

Последовательности гена Vp-1 В генома кластеризуются с геном-гомологом Vp-1 T. spelta, а последовательностей D генома с его донором Ae. tauschii (рис. 19) .

Рисунок Филогенетическое древо последовательностей, 19 .

относящихся к «частям гена построенное методом III+IV» Vp-1, максимального правдоподобия. Последовательности, полученные в работе, отмечены фигурами .

Полученные нами сиквенсы образуют отдельные кластеры, состоящие только из полученных нами последовательностей, что ожидаемо с учетом их отличия от гена Vp-1 пшеницевых и отсутствия ранее секвенированного гена у других дикорастущих сородичей пшеницы .

Образуется отдельный кластер включающий сиквенсы Th. intermedium (J1 и J2) и Th. ponticum (J1, J2, J3, Jvs1, Jvs2) вместе с D. villosum. Субгеном D. villosum встречается только в рекомбинантном геноме у Th. intermedium, соответственно данный рекомбинантный геном может присутствовать и у Th .

ponticum .

Выделяются еще две клады, включающие полученные нами последовательности. В одну из них входят последовательности Th. ponticum (St1, St4) и Ps.spicata (pssp3.1+pssp4.2 и pssp3.2+pssp4.1). Во вторую кладу, близкую первой входят последовательности Th. intermedium (St1,St2) и Th .

ponticum (St2, St3) .

Обращает на себя внимание то, что полученные нами сиквенсы Th .

bessarabicum попали в отдельную кладу. Хотя, следует заметить, что они были ближе к кластеру, объединяющему последовательности Th. intermedium (J1 и J2), Th. ponticum (J1, J2, J3, Jvs1, Jvs2) и D. villosum, чем к кластерам c последовательностями и и с Th. ponticum (St1, St4) Ps.spicata последовательностями Th. intermedium (St1,St2) и Th. ponticum (St2, St3) .

Следовательно, эволюция гена Vp-1 у Th. bessarabicum шла более быстрыми темпами. Вид пырея бессарабского является стрессоустойчивым к различным абиотическим факторам, в том числе к засолению (Gorham et al., 1985) .

Возможно, быстрые темпы эволюции являются адаптацией к условиям окружающей среды .

Последовательности гена Vp-1 Hordeum vulgare и Oryza sativa объединены в отдельном кластере. При анализе полученных нами нуклеотидных последовательностей Blast анализ показывал высокую степень гомологии, не только к пшеницевым, но и к последовательностям гена Vp-1 этих видов .

Последовательности гена пшеницы были ближе к Vp-1 последовательностям, относящимся к Th. bessarabicum и Dasypyrum villosum, чем к Ps.spicata, соответственно St геному .

3.4 Разработка молекулярного маркера, позволяющего отличать ген Vp-1 пырейного происхождения от генов Vp-1 мягкой пшеницы Хорошим объектом для предварительного изучения возможного влияния генов дикорастущих сородичей на признаки мягкой пшеницы являются пшенично-пырейные гибриды (ППГ). ППГ сочетают в своем геноме все три субгенома мягкой пшеницы и субгеном пырея. Одной из важных проблем данного подхода является идентификация различных аллельных вариантов генов пырея в присутствии трех гомеологичных генов мягкой пшеницы. В этой связи нами были разработаны молекулярные маркеры, позволяющие отличать ген Vp-1 пырейного происхождения от генов Vp-1 мягкой пшеницы .

3.4.1 Молекулярный CAPS-маркер Vp1BB4-HaeIII

Анализ сиквенсов, полученных с использованием праймеров Vp-1BB4 F/R (F: 5’- R: 5’CAATGAGCTGCAGGAGGGTGA -3’;

ATCATCCCTAACTAGGGCTACG -3’), позволил подобрать эндонуклеазу рестрикции HaeIII, используя которую удается выявить различия между последовательностями гена Vp-1 пырейного и пшеничного происхождения (Рис.20). В случае гена Vp-1 пырейного происхождения после амплификации и рестрикции HaeIII предположительно должны образовываться фрагменты, длинной около730, 550, 350 и 200 пн. В зависимости от аллельного состояния возможна амплификация фрагментов разного размера. При этом варианты гена Vp-1 пшеницы так же могут давать фрагменты, размер которых зависит от его аллельного состояния, но отличается от размера пырейных. Кроме того, необходимо учитывать возможную амплификацию и рестрикцию фрагментов генов –ортологов субгенома А и субгенома D мягкой пшеницы .

Рисунок Выравнивание нуклеотидных последовательностей заключенных между праймерами Vp-1BB4 F и Vp-1BB4 R (желтая заливка) с выделенным сайтом рестрикции HaeIII (5’-GG^CC-3’) (зеленая заливка) При использовании этого маркера на образце пырея среднего Th .

intermedium после амплификации и рестрикции маркер Vp1BB4_HaeIII на электрофореграмме детектируются фрагменты длиной приблизительно 900, 730, 550, 350 и 200 пн (Рис. 21). При этом на пшенице тот же маркер даёт фрагменты около 800, 490, 270 и 190 пн, то есть отличающиеся от фрагментов пырея среднего. Следовательно, данный маркер может быть использован для детекции гена Vp-1 пырейного происхождения (ThVp) в отдалённых гибридах пшеницы, полученных с участием пырея среднего в присутствии всех трех генов-гомологов Vp-1 мягкой пшеницы .

Рисунок 21. Электрофореграмма CAPS-маркера Vp1BB4_HaeIII на пырее среднем (1) и мягкой пшенице (7). М – маркер размеров Таким образом, разработанный подходит для CAPS-маркер идентификации гена Vp-1 пырея среднего и может использоваться для оценки существующих коллекций пшенично-пырейных гибридов. В связи с этим с помощью данного молекулярного маркера была оценена коллекция из образцов пшенично-пырейных гибридов (Отдел отдаленной гибридизации, Главный ботанический сад им. Н.В. Цицина РАН), которые могут служить материалом для последующего создания интрогрессивных линий пшеницы, несущих ген Vp-1 пырея .

По результатам постановки ПЦР с последующей рестрикцией маркера Vp1BB4_HaeIII на изучаемой коллекции ППГ нами были проанализированы все полученные фрагменты, не совпадающие с фрагментами, полученными на пшенице. В результате анализа было выявлено два диагностических фрагмента около 600 и 550 п.н., которые предварительно отнесли к аллелям пырейного происхождения. Данным фрагментам было присвоено название VpTh1 и VpTh2 соответственно (рис. 22). Следовательно, данный маркер может диагностировать три алелельных состояния: отсутствие аллеля, VpTh1 (500 пн) и VpTh2 (600 пн) .

Рисунок 22. Электрофореграмма продуктов рестрикции HaeIII после амплификации с праймерами Vp1BB4F и Vp1BB4R: 1 - 1807хв, 2 - 1807б/о, 3

- 1832, 5 - 1842, 6 - 1844, 7 - 1857, 8 - 1861б/о, 10 - 1861хв, 11 - 1856б, 12 б-к.; 4 - мягкая пшеница Иволга; 9 - пырей средний, М – маркер длины фрагментов ДНК 3.4.2 Молекулярный маркер Vivip Так как CAPS-маркер Vp1BB4-HaeIII позволял идентифицировать лишь два аллеля гена Vp-1 Th. intermedium, на другой полиморфный участок нами были подобраны праймеры Vivip F/R (Рис. 23) .

Рисунок Выравнивание нуклеотидных последовательностей 23 .

заключенных между праймерами Vivip F/R (зеленая заливка) Разработанный нами маркер Vivip позволяет выявить два аллеля пырейного происхождения: Th1 - 360 пн и Th2 - 366 пн. Созданный нами STS-маркер был протестирован на образцах мягкой пшеницы и наборе дикорастущих сородичей: Thinopyrum intermedium, Thinopyrum ponticum, Thinopyrum bessarabicum, Pseudoroegneria stripifolia, Dasypyrum villosum. Где мы имели возможность увидеть различия в амплифицированных фрагментах (Рис. 24). Как можно видеть на Рисунке 24, полученные продукты амплификации совпали по размеру с теоретически ожидаемыми, за исключением Dasypyrum villosum, у которого амплификация фрагмента (633 пн) проходила только с одного аллеля .

Рисунок 24. Электрофореграмма продуктов амплификации с праймерами Vivip F/R на дикорастущих сородичах пшеницы и мягкой пшенице. 1,2 – Thinopyrum intermedium; 3 – Пшеница Иволга, 4,5 - Thinopyrum ponticum; 6,7

- Dasypyrum villosum; 8,9 - Thinopyrum bessarabicum; 10,11 - Pseudoroegneria spicata;12– Пшеница Иволга; М – маркер длины фрагментов ДНК .

Амплифицируемые диагностические фрагменты 360 и 366 пн отличаются по размеру от фрагментов, амплифицируемых с пшеничного генома, следовательно, могут быть использованы для детекции аллелей гена ThVp пырейного происхождения в присутствии генов-гомологов TaVp пшеницы. По результатам постановки ПЦР с маркером Vivip на изучаемой коллекции ППГ было выявлено разнообразие по аллельному состоянию среди образцов (Рис. 25). Нами было выделено три состояния гена Vp-1 пырейного происхождения: отсутствие бэнда, Th1 (360 пн) и Th2 (366 пн) .

Рисунок 25. Электрофореграмма продуктов ПЦР с праймерами Vivip F/R: 1. – T.aestivum сорт Иволга; 2. – ППГ 1665, несет аллель Th2; 3. – ППГ 5256, несет аллель Th1; 4. – ППГ ЗП26; 5. – Th. intermedium; М – маркер длины фрагментов ДНК Разработанный нами маркер позволил выявить у тестируемых образцов ППГ два аллеля пырейного происхождения, фрагмент 360 пн и фрагмент 366 пн пырейного происхождения. Так же маркер позволяет выявить один фрагмент 374/377 пн, который амплифицируется с генома сразу двух видов пырея и выявляется у всех тестируемых образцов ППГ .

При анализе работы разработанных маркеров на образцах ППГ было выявлено, что аллель Th2 амплифицирующийся с помощью праймеров Vivip F/R, совпадает с аллелем VpTh2 полученным при рестрикции HaeIII продуктов амплификации с праймерами Vp1BB4 .

В связи с тем, что образцы 47, 1432, 1508, 1754, 1779, 1832, 1844, 1857, 1879, 4056, 5152, 1795 сильно ост, 1807 безост, 1861 хвост, 1865 б/к кр, 1870 ост. показали гетерогенность по результатам ПЦР, они были в дальнейшем исключены из анализа .

При сопоставлении результатов анализа коллекции ППГ из 85 образцов с помощью маркеров Vp1BB4_HaeIII и Vivip нами были выявлены четыре возможных класса (табл.4):

Отсутствие диагностических бэндов как на маркере 1 .

Vp1BB4_HaeIII, так и на маркере Vivip (36 образцов) Аллель на маркере Vp1BB4_HaeIII и отсутствие 2. VpTh1 диагностических бэндов на маркере Vivip (11 образцов) Аллель VpTh2 на маркере Vp1BB4_HaeIII и аллель Th2 на 3 .

маркере Vivip (25 образцов) Отсутствие диагностических бэндов как на маркере 4 .

Vp1BB4_HaeIII и аллель Th1 на маркере Vivip (13 образцов)

–  –  –

был использован метод прямой оценки (подсчет индекса прорастания) путем проращивания зерновок в чашках Петри в темноте и на свету. Индекс прорастания отражает уровень покоя семян, который считается главным фактором устойчивости зерна к прорастанию в колосе. Индекс прорастания отражает уровень покоя семян, который считается главным фактором устойчивости зерна к предуборочному прорастанию в колосе (Беркутова и Буко, 1982). Индекс прорастания (ИП) вычисляли по Walker- Simmons (1987) с модификациями. Для удобства анализа полученные результаты были разбиты на 5 классов с интервалом ИП=0,2. При оценке ИП в чашках Петри в темноте нами была выявлена очень слабая дифференциация и большая часть образцов показали себя как не устойчивые (Табл. 5) .

Таблица 5. Разбиение по классам образцов ППГ по результатам оценки индекса прорастания в чашках Петри в темноте

–  –  –

Оценка в чашках Петри на свету показала более широкую дифференциацию между образцами. Четко выделяется один образец 1765кр, имеющий выдающиеся низкие показатели ИП (=0,15) и попадающий в первый класс. А так же выделяются 10 образцов (150 кр., 1416 безост., 1735, 1774, 1876, 47, 1533, 12, 1777, 1692), имеющие средние показатели ИП (0,41и попадающие в третий класс (Табл. 6) .

Таблица 6 Разбиение по классам образцов ППГ по результатам оценки индекса прорастания в чашках Петри на свету

–  –  –

Другим наиболее приближенным к естественным условиям методом оценки устойчивости к предуборочному прорастанию является оценка устойчивости непосредственно в колосе. Колосья, убранные в фазу полной спелости предварительно замачивали в дистиллированной воде в течении 1 часа и размещали на стеллажи в вертикальном положении в снопиках по 5 колосьев каждого образца. Снопики, помещенные в камеру, 3 раза в день опрыскивались водой в течение 5 минут .

Рисунок 26. Пример четырехбальной шкалы визуальной оценки, где А

– образец 1451 – 0 баллов; Б - образец 150кр – 1 балл; В - образец 1626 – 2 балла; Г - образец 4044 – 3 балла Нами проводилась визуальная оценка и образцы оценивались по 4бальной шкале, где «3» соответствует полностью проросшим образцам, а «0»

- образцам без явных признаков прорастания (Рис. 26). Уже по результатам первой визуальной оценки, степени прорастания зерновок в колосьях, проводимой на третий день провокации, выделялось несколько образцов без явных признаков прорастания. При второй визуальной оценке, проводимой на седьмой день, выделялось 5 образцов, не проявивших явных признаков прорастания. Однако при визуальной оценке невозможно учесть только наклюнувшиеся зерновки, поэтому нами учитывались такие показатели, как доля проросших зерновок в колосе и индекс прорастания .

Таблица 7. Разбиение по классам образцов ППГ по результатам оценки доли проросших семян в колосе на третий день провокации

–  –  –

При оценке доли всех проросших зерен в колосе треть образцов (34 образца ППГ) были отнесены к 8 и 9 группам, где доля проросших зерен составляла больше 0,85. Это свидетельствует о том, что при жестких условиях и длительном периоде провокации некоторые образцы имеют более сжатый период покоя .

Образец 1451, показавший минимальное значение доли проросших в колосе (0,01), показал высокое значение GI (0,87). Так как образец 1451 чрезвычайно труден в обмолоте и имеет жесткие цветочные чешуи, плотно прилегающие к зерновке, то его высокая устойчивость к прорастанию в колосе объясняется, прежде всего, именно архитектоникой колоса, а сами семена отличаются низкой устойчивостью к прорастанию на корню .

Архитектоника колоса, по-видимому, также объясняет устойчивость в колосе образцов 1748 и 1874 (0,07 и 0,09) при слабой устойчивости самих семян к прорастанию на корню (GI 0,72 и 0,86). Образец 1765 кр отличается низким показателем доли проросших в колосе (0,02) и GI (0,15), следовательно, его устойчивость к прорастанию на корню может быть объяснена в равной степени как характеристиками самого семени, так и колоса. Образцы 1735, 1774 и 150 кр показали высокую устойчивость как по показателю доли проросших в колосе, так и GI, что позволяет их отнести в целом к устойчивым. Образцы 4044, 1416 ост, 1792, 1803 показали высокие показатели доли проросших в колосе и GI, что позволяет их отнести к неустойчивым к прорастанию на корню. Следовательно, у данных образцов архитектоника колоса не в состоянии компенсировать низкую устойчивость семян к прорастанию на корню. Образцов с низким значением GI и высоким значением доли проросших в колосе нами не выявлено (Табл. 9) .

Таблица 9 Образцы ППГ имеющие крайние показатели GI в чашках петри и доли проросших в колосе Низкое значение GI Высокое значение GI Низкое значение доли 1765 кр., 1735, 1744, 1451, 1748, 1874 проросших в колосе 150кр .

Высокое значение доли 4044, 1416 ост, 1792, не выявлено проросших в колосе 1803 По результатам оценки можно сказать, что в общей своей массе ППГ обладают низкой устойчивостью к предуборочному прорастанию и низким уровнем покоя семян. Возможно, это связано с негативным влиянием пырейного генома. К примеру, в исследованиях Крупнова и соавторов (2012) на рекомбинантных инбредных линиях и почти изогенных линиях установлено отрицательное влияние 6Agi хромосомы пырея среднего на устойчивость к прорастанию на корню .

Говоря об архитектонике колоса, мы не можем упустить из вида другие морфологические признаки, способные оказывать влияние на устойчивость к предуборочному прорастанию. Устойчивость к предуборочному прорастанию сложный комплексный признак, на который влияют множество факторов. Одновременное генотипирование и фенотипирование растений по нескольким маркерам повышает эффективность селекционного отбора (Lande and Thompson, 1990).

Поэтому мы оценивали коллекцию ППГ на комплекс фенотипических признаков, которые, по литературным данным, могут оказывать влияние на устойчивость к предуборочному прорастанию:

такие как архитектоника колоса – остистость, цвет колосковых чешуй, трудность обмолота; и цвет зерновки .

Колосья ППГ в целом трудоемки в ручном обмолоте, но среди 101 образца выделялось 4, с грубыми, плотно прижатыми к зерну цветковыми чешуями, что значительно затрудняло процесс обмолота и, как известно, это способствуют задержке поглощения воды (Chen et al., 2008; Kong et al., 2008) .

Среди 101 образца ППГ 19 были остистые, а 82 безостые. При этом, основываясь на исследованиях King & Richards (1984), безостые колосья пшеницы, поглощают воду более медленно, чем остистые, что уменьшает предуборочное прорастание в колосе вдвое .

Широко известна связь красного цвета зерна с толерантностью к прорастанию на корню, которую обуславливают сцеплением генов определяющих красный цвет зерна с генами, обеспечивающими устойчивость к предуборочному прорастанию (Warner et al., 2000) .

Коллекция ППГ имеет красное зерно, однако четко выявляются различия в интенсивности окраски. Большинство образцов ППГ, а именно 79 образцов, имели светло-красную окраску семенной кожуры и 20 темно-красную окраску. Кроме того среди 101 образца ППГ 2 имеют зеленую (голубую) окраску зерна .

При оценке цвета колосковых чешуй, среди 101 образца ППГ выделялось 11 красноколосых и 10 белоколосых. Беркутовой и Буко (1982) было установлено, что больше всего сдерживают наклевывание семян вытяжки из колосковых чешуй красноколосой пшеницы .

Чтобы всесторонне изучить коллекцию ППГ нами был учтен дополнительный генотипический признак, позволяющий оценить пшеничную составляющую генома гибридов. Для этого нами был использован эффективный кодоминантный маркер, позволяющий выявлять аллели гена Vp-1B, рекомендованный для использования в MAS-селекции пшеницы (Yang et al., 2007; Xia L. Q. et al. 2007). Аллельный состав коллекции ППГ по гену Vp-1 пшеничного происхождения был оценен нами с помощью STS-маркера Vp-1B3 (Yang et al., 2007) и выявлены 2 аллеля гена Viviparous-1В: Vp-1Bа (652 п.н.) и Vp-1Bc (569 п.н.) (Рис. 27). Аллель Vp-1Bc содержит делецию 83 п.н. в интроне III, данный аллель ассоциируют с устойчивость пшеницы к предуборочному прорастанию (Liuling et al., 2000;

Fedorov et al., 2003; Yang et al., 2007) .

Рисунок 27. Электрофореграмма продуктов ПЦР с праймерами Vp1B3 на ген Vp-1 пшеничного происхождения на образцах ППГ Среди 101 образца 46 несли аллель Vp-1Ba, 31 образец несли аллель Vp-1Bc и 21 образец показал расщепление по присутствию двух аллелей .

Структура изучаемой коллекции ППГ имела следующий вид: 47% образцов несли аллель Vp-1Ba, 32% образцов несли аллель Vp-1Bc, 16% образцов показали гетерогенность, 5% были гетерозиготами (последние две группы в дальнейшем анализе не участвовали) .

Результаты оценки полиморфизма коллекции ППГ по генотипическим и морфологическим признакам представлены в таблице 1 в приложении .

3.6 Анализ влияния гена ряда генотипических и морфологических признаков на устойчивость к предуборочному прорастанию у ППГ В ходе нашей работы нами были получены данные по аллельному состоянию генов Vp-1 пырейного и пшеничного происхождения у ППГ, изучено разнообразие ППГ по морфологическим признакам. Была проведена оценка коллекции ППГ и получены данные по индексу прорастания зерен при провокации в чашках Петри и доля проросших зерен при провокации непосредственно в колосе, что используется нами, как показатели устойчивости к предуборочному прорастанию. На основе полученных данных нами была проведена статистическая обработка с целью выявления взаимосвязей .

Изучение взаимосвязи проводили только по образцам, не имеющим полиморфизма по аллельному состоянию. Образцы, показавшие расщепление были удалены из последующего анализа. Статистический анализ взаимосвязи индексом прорастания или долей проросших семян, в качестве зависимой переменной, и генотипическими и/или морфологическими признаками устанавливался с помощью программного обеспечения Statistica, методом дисперсионного анализа (ANOVA) .

–  –  –

Классы Рисунок 28 Диаграмма показателей среднего индекса прорастания по четырем аллельным вариантам гена Vp-1 пырейного происхождения построенная на основе метода наименьших квадратов Были получены достоверные различия, так как Fфакт=6,6092 больше Fтеор=3,105, а уровень значимости различий p=0,0039 (Табл. 9). Выявлены статистически значимые различия между образцами ППГ класса 1, не несущими выявленных нами аллелей, и образцами класса 4, несущими аллель Th1. А также между образцами класса 3, несущими аллель ThVp1 и образцами класса 4, несущими аллель Th1. Их доверительные интервалы не перекрывались (Рис. 28). То есть образцы, несущие аллель Th1 гена Vp-1 пырея среднего достоверно отличался образцов класса 1 и класса 3, имеющих довольно высокие показатели ИП .

При подсчете НСР между классами были выявлены дополнительные различия образцов класса 2, имеющего довольно низкие показатели ИП, от образцов класса 1 и 3 (Табл. 10). Можно предположить, что аллель Th2 так же имеет взимосвясь с устойчивостью к предуборочному прорастанию, однако его проявление не выражено .

Таблица10. Выявление наименьшей существенной разности между образцами ППГ разных классов гена Vp-1 пырейного происхождения Класс 1 (-) Класс 2 Класс 3 Класс 4

–  –  –

Обращает на себя внимание класс 4, несущий аллель Th1, который имеет более низкие показатели доли проросших зерен в колосе, кроме того нет перекрытия доверительных интервалов между образцами класса 4 и класса 2 (Рис. 29) .

Классы Рисунок 29 Диаграмма показателей средней доли проросших зерен в колосе по четырем классам гена Vp-1 пырейного происхождения построенная на основе метода наименьших квадратов При оценке взаимосвязи аллельных вариантов гена Vp-1 пырейного происхождения и долей проросших семян в колосе были получены результаты, отличные от результатов оценки взаимосвязи с показателями ИП в чашках Петри. Это следовало ожидать, так как при оценке устойчивости непосредственно в колосе на толерантность влияют иные факторы, такие как архитектоника колоса. Не смотря на это, в обоих случаях оценки выделяются образцы ППГ класса 4, несущие аллель Th1 гена Vp-1 пырейного происхождения .

–  –  –

Vp-1Bc Vp-1Ba Рисунок 30 Диаграмма показателей среднего индекса прорастания по четырем аллельным вариантам гена Vp-1 пшеничного происхождения построенная на основе метода наименьших квадратов Не было выявлено существенных различий между долей проросших зерен в колосе и аллельным состоянием гена Vp-1 В-генома мягкой пшеницы (Табл.13; Рис. 31) .

Таблица 13 Результаты статистического анализ взаимосвязи между устойчивостью к предуборочному прорастанию, доле проросших зерен в

–  –  –

Vp-1Bc Vp-1Ba Рисунок 31. Диаграмма показателей среднего индекса прорастания по четырем аллельным вариантам гена Vp-1 пшеничного происхождения построенная на основе метода наименьших квадратов Из-за сложного наследования устойчивости к прорастанию на корню, которая находится под сильным влиянием факторов внешней среды и эффектов взаимодействия генотип среда, сложно предположить причину низких показателей устойчивость у образцов несущих аллель Vp-1Bc .

Причиной того, что аллель Vp1Bc, ассоциированный с устойчивостью, не оказал влияния на покой семян может служить одновременное присутствие в геноме ППГ пшеничной и пырейной составляющей и их взаимодействии .

Возможно, геном пырея вносит изменения в регуляцию устойчивости к прорастанию на корню, что, как обсуждалось ранее, может быть вызвано негативным влиянием 6Agi хромосомы (Крупнов, 2012) .

–  –  –

Рисунок 35 Диаграмма показателей среднего ИП по аллельному состоянию гена Vp-1 пырейного происхождения внутри групп со светло- и темно-красными зернами Согласно полученным нами результатам аллельное состояние Th1 гена Vp-1 пырейного происхождения связано с устойчивостью только в светлокраснозерных образцах ППГ. Особенностью работы с ППГ является наличие генома пырея, который не только оказывает дополнительное влияние на устойчивость к предуборочному прорастанию, но и на окраску семенной кожуры. Ранее различия в проявлении гена Vp-1 на образцах тритикале, различающихся по интенсивности красно окраски семенной оболочки было продемонстрировано Майером (2012). Отсутствие различий в проявлении действия гена Vp-1 в темно-краснозерной группе образцов может быть связано с накоплением продуктов флаваноидного пути (проантоцианидин, флобафен) в семенной оболочке красного зерна, которые в свою очередь являются ингибиторами прорастания. Таким образом, темно-красная окраска зерна создает общий уровень устойчивости к предуборочному прорастанию, при котором проявление генов Vp-1 пырейного происхождения не столь существенно .

–  –  –

Рисунок 36. Диаграмма показателей средней доли проросших зерен в колосе по аллельному состоянию гена Vp-1 пырейного происхождения внутри групп со светло- и темно-красными зернами У группы образцов с темно-красной окраской зерен класс 1, не несущий выявленных аллелей пырейного происхождения имел заметно более низкие показатели доли проросших семян в колосе, что может быть связано с общим влиянием интенсивности окраски зерна на устойчивость к предуборочному прорастанию. Однако статистически значимых отличий не было выявлено .

Полиморфизм по устойчивости исследуемых образцов ППГ в нашем случае объясняется различиями в пырейной генетической компоненте. Нами не выявлено существенных различий в устойчивости к прорастанию на корню между образцами с пшеничными аллелем Vp1Bс и Vp1Ba. Так как ППГ различаются между собой по пырейной компоненте, то можно ожидать, что различия в устойчивости к прорастанию на корню вызваны, в том числе, различиями в комбинациях пырейных хромосом (на геномном уровне), различиями по третьей гомеологичной группе, где локализованы гены R и Vpна хромосомном уровне) или структурно-функциональными различиями в генах Vp-1 (на генном уровне) .

ЗАКЛЮЧЕНИЕ

В результате проведения диссертационного исследования впервые получены нуклеотидные последовательности гена Vp-1 у двух дикорастущих видов трибы пшеницевых: Thinopyrum intermedium и Thinopyrum ponticum. На основе различий в полученных нуклеотидных последовательностях созданы два молекулярных маркера, позволяющие выявить ген Vp-1 пырейного происхождения, в том числе в присутствии генома пшеницы. Впервые изучен полиморфизм уникальной коллекции октоплоидных ППГ по признакам ассоциированным с устойчивостью к предуборочному прорастанию .

Секвенированы и охарактеризованы различные аллельные варианты частичных последовательностей гена Vp-1 у пырея среднего и пырея понтийского. В общей сложности было получено следующее количество аллельных вариантов: Th. intermedium – 6 аллельных вариантов (1 экзон); 9 (1,2,3 экзоны, 1,2,3 интроны); 7 (4,5 экзоны, 3,4,5 интроны); 6 (5, 6 экзоны, 5 интрон). Th. ponticum - 15 аллельных вариантов (1 экзон); 13 (1,2,3 экзоны, 1,2,3 интроны); 9 (4,5 экзоны, 3,4,5 интроны); 9 (5,6 экзоны, 5 интрон) .

Клонированы и секвенированы частичные последовательностей гена Vp-1 у трех дикорастущих сородичей пшеницы: Ps. spicata 2 аллельных вариантов (1 экзон); 2 (4,5 экзоны, 3,4,5 интроны); 2 (5,6 экзоны, 5,6 интроны). D. villosum 2 аллельных варианта (4,5 экзоны, 3,4,5 интроны); 2 (5,6 экзоны, 5,6 интроны). Th. bessarabicum 3 аллельных варианта (1,2,3 экзоны, 1,2,3 интроны); 4 (4,5 экзоны, 3,4,5 интроны); 1 (5,6 экзоны, 5,6 интроны) .

Соединены полноразмерные последовательности гена Vp-1 пырея среднего и пырея понтийского: четыре нуклеотидные последовательности Th. intermedium, разнесенные по субгеномам St (St1и St2) и J (J1 и J2);семь нуклеотидных последовательностей разнесенным по Th. ponticum, субгеномам St (St1, St2, St3 и St4) и J (J1, J2 и J3) .

При анализе гипотетической аминокислотной последовательности гена Vp-1 Th.intermedium и Th.ponticum выявлена высокая консервативность функционального В3 домена .

С помощью филогенетического анализа было показано, что последовательности Th. intermedium и Th. ponticum, относящиеся к субгеному St, попадают в отдельный кластер. А последовательности, отнесенные к J субгеному, попадают в кластер, близкий к кластеру D-генома мягкой пшеницы и Aegilops tauschii. Показано, что последовательности гена Vp-1 D .

наиболее отдалены от всех остальных полученных villosum последовательностей .

Созданы молекулярные маркеры: CAPS Vp-1BB4 F/R /HaeIII и STS маркер Vivip, позволяющие идентифицировать три аллеля гена Vp-1 пырейного происхождения Созданные маркеры (Th1, Th2, Th3) .

позволяющие различать гены Vp-1 гены пырея от Vp-1 генов пшеницы, при их одновременном присутствии в одном геноме (ППГ) .

Проведена оценка 101 образца ППГ на аллельное состояние генов Vp-1 пырейного происхождения. Среди 101 образца ППГ у 13 образцов амплифицируется аллель Th1, у 11 образцов – аллель Th2/VpTh2, у 25 образцов – аллель VpTh1 и 36 образцов отсутствовала амплификация аллелей пырейного происхождения. У 16 образцов было выявлено расщепление по наличию-отсутствию аллелей .

Изучена степень разнообразия внутри коллекции ППГ по фенотипическим признакам, оказывающим влияние на устойчивость к прорастанию на корню. Среди 101 образца ППГ 19 - остистые, 11 – красноколосые, 4 – труднообмолачиваемые, 79 – белозерные, 20 – краснозерные, 2 – зеленозерные .

У группы образцов со светло-красной окраской зерен была выявлена взаимосвязь между аллельным состоянием Th1 и устойчивостью к прорастанию зерна на корню в виде ИП в чашках Петри .

ВЫВОДЫ

1. Клонированы и секвенированы частичные нуклеотидные последовательности функциональных генов Vp-1 дикорастущих сородичей пшеницы: Th. intermedium, Th. ponticum, Th. bessarabicum, Ps. spicata, D. villosum. Показано, что у дикорастущих сородичей пшеницы наиболее вариативные части гена Vp-1 – экзон 1 и интроны 3 и 5 .

2. На основе частичных нуклеотидных последовательностей собрано 11 гипотетических полноразмерных последовательностей гена Vp-1, отнесенных к субгеномам J и St: Th. intermedium - 4, Th. ponticum - 7 .

При сравнительном анализе гипотетических аминокислотных последовательностей в области функционального домена В3 гена Vpвыявлены только единичные замены аминокислот у отдельных последовательностей: thint.St1 (L/R); thpon.St2 (L/P); thpon.J2 (G/R);

thint.St2 (E/G); thpon.J1 (T/I); thpon.J3 (T/I) .

3. Филогенетический анализ генов Vp-1 Th. intermedium и Th. ponticum показал, что ближе к мягкой пшенице и ячменю сиквенсы относящиеся к субгеному J. Сиквенсы субгенома St формируют отдельный кластер. Последовательности гена Vp-1 D.villosum кластеризуются вместе с частью нуклеотидных последовательностей генов Vp-1 Th. intermedium и Th. ponticum, что свидетельствует в пользу активного участия D.villosum в аллополиплоидизации пырея среднего и пырея понтийского .

4. Созданы CAPS маркер (Vp-1BB4/HaeIII) и STS маркер (VivipF/R), на гены Vp-1 Thinopyrum, позволяющие идентифицировать эти гены в геномном окружении пшеницы и выявлять различные аллельные варианты генов Vp-1 Thinopyrum .

5. С помощью разработанных маркеров Vp-1BB4/HaeIII и VivipF/R показан полиморфизм генов Vp-1 пырейного происхождения среди 101 образца коллекции пшенично-пырейных гибридов .

–  –  –

СПИСОК ЛИТЕРАТУРЫ

Алтухов, Ю.П. Внутривидовое генетическое разнообразие:

1 .

мониторинг и принципы сохранения / Ю.П. Алтухов // Генетика. - 1995. - Т .

31 - № 10. - C. 1331-1357 .

Беркутова, Н. С. Оценка и отбор зерновых культур на 2 .

устойчивость к прорастанию в колосе : Обзор / Н. С. Беркутова, О. А. Буко .

— М., 1982. — С. 59 .

Беспалова, Л.А. Применение молекулярных маркеров в селекции 3 .

пшеницы в Краснодарском НИИСХ им. П.П. Лукьяненко / Л.А. Беспалова // Вавиловский журнал генетики и селекции – 2012. –Т.16. - №1. – С.37-43 .

Давоян, A. О., Давоян, A. Р. Интрогрессивные линии мягкой 4 .

пшеницы с генетическим материалом Agropyron glaucum / А. О. Давоян, А.Р .

Давоян // Вавиловский журнал генетики и селекции – 2015. – Т. 19. – №. 1. – С. 83-90 .

Дубина, Е. В., Мухина, Ж. М. Молекулярные маркеры и их 5 .

использование в селекционно-генетических исследованиях / Е.В. Дубина, Ж.М. Мухина // Политематический сетевой электронный научный журнал Кубанского государственного аграрного университета. – 2011. – №. 66. – С .

1-11 .

Зиновьева, Н. А. Современные методы генетического контроля 6 .

селекционных процессов и сертификация племенного материала в животноводстве: учебное пособие / Н.А. Зиновьева, П.М. Кленовицкий, Е.А .

Гладырь, А.А. Никишов // М.:изд-во РУДН. – 2008.- 329 с .

Календарь, Р. Н., Глазко, В. И. Типы молекулярно-генетических 7 .

маркеров и их применение / Р.Н. Календарь, В.И. Глазко //Физиология и биохимия культурных растений. – 2002. – Т. 34. – №. 4. – С. 279-296 .

Крупнов, В. А., Крупнова, О. В. Подходы по улучшению качества 8 .

зерна пшеницы: селекция на число падения / В.А. Крупнов, О.В. Крупнова //Вавиловский журнал генетики и селекции. – 2015. – Т. 19. – №. 5. – С. 604Крупнов, В. А., Сибикеев, С. Н., Крупнова, О. В. Генетический 9 .

контроль покоя и устойчивости к предуборочному прорастанию семян у пшеницы / В.А. Крупнов, С.Н. Сибикеев, О.В. Крупнова //С.-х. биология. – 2010. – №. 3. – С. 3-16 .

Майер Н. К. Применение молекулярно-генетических маркеров на 10 .

устойчивость к прорастанию зерна на корню у тритикале: диссертационная работа // РГАУ-МСХА им. К.А. Тимирязева. – 2011 .

Мартынов, С. П., Добротворская, Т. В. Генеалогический и 11 .

статистический анализ генетического разнообразия с помощью информационно-аналитической системы генетических ресурсов пшеницы gris / С.П. Мартынов, Т.В. Дабротворская //труды по прикладной ботанике, генетике и селекции. - Т. 169.– 2012. – С. 193 .

Невский, С. А. О системе трибы Triticie.« //Тр. Бот. ин-та АН 12 .

СССР», сер. I. Флора и систематика высш. растений. – 1933. – №. 1 .

Плотникова, Я. Эффективность генов возрастной 13. A .

устойчивости пшеницы к бурой ржавчине lr22b, lr34, lr37 в западной сибири и цитофизиологическая основа их действия / А.Я. Плотникова // Вавиловский журнал генетики и селекции. – 2014. – Т. 16. – №. 1. – С. 123-131 .

Пухальский, В.А. Проблемы генетической теории селекции 14 .

растений. / В.А. Пухальский // Информ. вестн. ВОГиС / Вавилов. о-во генетиков и селекционеров. -Новосибирск, 2005. - Т. 9. - № 3. - С. 306-316 .

Пухальский, В.А., Проблемы естественного и приобретенного 15 .

иммунитета растений к развитию идей Н.И. Вавилова / В.А. Пухальский, Т.И. Одинцова, Л.И. Извекова, Э.Н. Андреева, Т.В. Коростылева, Е.А .

Истомина, А.А. Славохотова, А.Н. Шиян, Г.В. Козловская, Л.А. Оболенкова, Е.Д. Бадаева, Е.Н. Билинская // Информ. вестн. ВОГиС / Вавилов. о-во генетиков и селекционеров. - Новосибирск, 2007. - Т. 11. - № 3/4. - С. 631Рогожин, В. В., Рогожина, Т. В. Физиолого-биохимические 16 .

механизмы прорастания зерновок пшеницы / В.В. Рогожин, Т.В. Рогожина //Вестник Алтайского государственного аграрного университета. – 2011. – Т .

82. – №. 8. – С. 17-21 .

Рубец, В. С., Нгуен, Т. Т. Л., Пыльнев, В. В. Система 17 .

селекционной оценки устойчивости озимой тритикале к прорастанию на корню / В. С. Рубец, Т. Т. Л. Нгуен, В. В. Пыльнев //Известия ТСХА. М.: Издво РГАУ-МСХА. – 2012. – №. 1. – С. 132-141 .

Третьяков, Н. Н., Кошкин, Е. И., Новиков, Н. Н. Физиология и 18 .

биохимия сельскохозяйственных растений. / Н. Н. Третьяков, Е. И. Кошкин, Н. Н. Новиков, Н.М. Макрушин, Н.А. Пильщикова / Москва : КолосС, 2005. – 640 с .

Упелниек, В. П., Белов, В. И., Иванова, Л. П. Долгова, СП, 19 .

Демидов, АС Наследие академика НВ Цицина-современное состояние и перспективы использования коллекции промежуточных пшенично-пырейных гибридов / В.П. Упелниек, В.И. Белов, Л.П. Иванова, С.П. Долгова, А.С .

Демидов //Вавиловский журнал генетики и селекции. – 2012. – Т. 16. – №. 3 .

– С. 667-674 .

Хавкин Э.Е. Молекулярная селекция растений: ДНК-технологии 20 .

создания новых сортов сельскохозяйственных культур / Э.Е. Хавкин //Сельскохозяйственная биология. – 2003. – №. 3. – с. 26-41 .

Хлесткина Е.К., Молекулярные маркеры в генетических 21 .

исследованиях и в селекции / Е.К. Хлесткина // Вавиловский журнал генетики и селекции. – 2013. – Т.17, №4/2. – с. 1044-1054 Цвелев Н.Н. Злаки СССР. – М.: Наука, 1976. – 788 с .

22 .

Цвелев, Н. Н. О возможности деспециализации путем 23 .

гибридогенеза на примере эволюции трибы Triticeae семейства злаков (Poaceae) / Н.Н. Цвелев //Журнал общей биологии. – 1975. – Т. 36. – №. 1. – С .

90-99 .

Цицин, Н.В. Многолетняя пшеница / М.:Наука, 1978. – 16 с .

24 .

Шишлов, М. П. Лабораторная климатическая установка для 25 .

оценки форм тритикале на устойчивость к прорастанию в колосе / М. П .

Шишлов, Н. П. Шишлова // Селекция и семеноводство. — 1994. — № 2. — С .

26–29.]

26. Adderley, S.J. Evolution and Origin of Polyploid Triticeae (Poaceae) Revealed through the Nuclear pgk1 Gene / S.J. Adderley // Saint Mary’s university. – 2012. Halifax, Nova Scotia. – P 34 .

27. Anderson, J.A., Sorrells, M.E., Tanksley, S.D. RFLP analysis of genomic regions associated with resistance to preharvest sprouting in wheat. / J.A .

Anderson, M.E. Sorrells, S.D. Tanksley // Crop Sci – 1993. - Vol.33 - P.453–459 .

28. Armstrong, J. M. Hybridization of Triticum and Agropyron: I .

Crossing results and description of the first generation hybrids / J. M. Armstrong //Canadian Journal of Research. – 1936. – Т. 14. – №. 5. – С. 190-202 .

29. Baghizadeh, A., Karimzadeh, G. H. The Selection of Secondary Tritipyrum Genotypes by Genomic In Situ Hybridization (GISH) / A. Baghizadeh, G.H. Karimzadeh //JWSS-Isfahan University of Technology. – 2009. – Т. 13. – № .

48. – P. 65-75 .

30. Bailey, P. C. Genetic map locations for orthologous Vp1 genes in wheat and rice. / P.C. Bailey, R.S. McKibbin, J.R. Lenton, M.J. Holdsworth, J.E .

Flintham, M.D. Gale // Theor Appl Genet – 1999. - P.281–284 .

31. Banks, P. M. Varying chromosome composition of 56-chromosome wheat Thinopyrum intermedium partial amphiploids / P.M. Banks, S.J. Xu, R.C .

Wang, P.J Larkin //Genome. – 1993. – Т. 36. – №. 2. – С. 207-215 .

32. Barkworth, M. E., Dewey, D. R., Atkins, R. J. New generic concepts in the Triticeae of the Intermountain Region: Key and comments / M.E .

Barkworth, D.R. Dewey, R.J. Atkins //The Great Basin Naturalist. – 1983. – С .

561-572 .

33. Baskin, J. M., Baskin, C. C. A classification system for seed dormancy / J.M. Baskin, C.C. Baskin //Seed science research. – 2004. – Т. 14. – №. 1. – С. 1-16 .

34. Bi, H. H. Characterization of DFR allelic variations and their associations with pre-harvest sprouting resistance in a set of red-grained Chinese wheat germplasm / H.H. Bi, Y.W. Sun, Y.G. Xiao, L. Q. Xia //Euphytica. – 2014 .

– Т. 195. – №. 2. – С. 197-207 .

35. Biddulph, T. B. Seasonal conditions influence dormancy and preharvest sprouting tolerance of wheat (Triticum aestivum L.) in the field / T.B .

Biddulph, J.A. Plummer, T.L. Setter, D.J. Mares //Field Crops Research. – 2008. – Т. 107. – №. 2. – С. 116-128 .

36. Bies-Etheve, N. Importance of the B2 domain of the Arabidopsis ABI3 protein for Em and 2S albumin gene regulation / N. Bies-Etheve, A. da Silva Conceicao, M. Koornneef, K. Lon-Kloosterziel, C. Valon, M. Delseny //Plant molecular biology. – 1999. – Т. 40. – №. 6. – С. 1045-1054 .

37. Bobb, A. J., Eiben, H. G., Bustos, M. M. PvAlf, an embryospecific acidic transcriptional activator enhances gene expression from phaseolin and phytohemagglutinin promoters / Bobb A.J., Eiben H.G., Bustos M.M. //The Plant Journal. – 1995. – Т. 8. – №. 3. – С. 331-343 .

38. Bowden, J. Sorghum midge, Contarinia sorghicola (Coq.), and other causes of grain-sorghum loss in Ghana / J. Bowden //Bulletin of Entomological Research. – 1965. – Т. 56. – №. 01. – С. 169-189 .

39. Cai, X., Jones, S. S. Direct evidence for high level of autosyndetic pairing in hybrids of Thinopyrum intermedium and Th. ponticum with Triticum aestivum / X. Cai, S.S. Jones //Theoretical and applied genetics. – 1997. – Т. 95. – №. 4. – С. 568-572 .

40. Cao, J. Regeneration of herbicide resistant transgenic rice plants following microprojectile- mediated transformation of suspension culture cells / J .

Cao, X. Duan, D. McElroy, R. Wu // Plant Cell Rep: – 1992. – 11. – P. 586–591 .

41. Chang, C. Validating a novel allele of viviparous-1 (Vp-1Bf) associated with high seed dormancy of Chinese wheat landrace, Wanxianbaimaizi / C. Chang, J.M. Feng, H.Q. Si, B. Yin, H.P. Zhang, C.X. Ma // Molecular Breeding: – 2010. - 25 - P. 517-525

42. Chen, C.X., Cai, S.B., Bai, G.H. A major QTL controlling seed dormancy and pre-harvest sprouting resistance on chromosome 4A in a Chinese wheat landrace / C.X. Chen, S.B. Cai, G.H. Bai // Mol Breeding:

- 2008. - P.351– 358 .

43. Chen, H. Molecular marker analysis on common wheat landrace Chinese spring alien chromosome lines derived from Thinopyrum bessarabicum Love / H. Chen, B.L. Qian,, L.F. Zhuang, Q.Z. Chen, G. Feng, Z.Y. Pei, D.J. Liu // Acta Agronomica Sinica. – 2007. – Т. 8. – P. 4 .

44. Chen, Q. Molecular characterization of the genome composition of partial amphiploids derived from Triticum aestivum X Thinopyrum ponticum and T. aestivum X T. intermedium as sources of resistance to wheat streak mosaic virus and its vector, Aceria tosichella../ Q. Chen, R.L. Conner, F. Ahmad, A. Laroche, G. Fedak, J.B. Thomas // Theor Appl Genet. – 1998. – 97. – Р. 1-8 .

45. Chen, Q. Detection of alien chromatin introgression from Thinopyrum into wheat using S genomic DNA as a probe--a landmark approach for Thinopyrum genome research / Q. Chen // Cytogenet Genome Res., 2005;109(1Chen, Q. Molecular cytogenetic evidence for a high level of chromosome pairing among different genomes in Triticum aestivum-Thinopyrum intermedium hybrids / Q. Chen, R.L. Conner, A. Laroche, F Ahmad // Theor Appl Genet. - 2001. - 102. – Р. 847–852 .

47. Charmet, G. Wheat domestication: lessons for the future / G. Charmet //Comptes rendus biologies. – 2011. – Т. 334. – №. 3. – Р. 212-220 .

48. Cox, T. S. Progress in breeding perennial grains / T.S. Cox, D.L. Van Tassel, C.M. Cox, L.R. DeHaan //Crop and Pasture Science. – 2010. – Т. 61. – № .

7. – Р. 513-521 .

49. Cui, H. Introgression of bread wheat chromatin into tall wheatgrass via somatic hybridization / H. Cui, Z. Yu, J. Deng, X. Gao, Y. Sun, G. Xia // Planta

– 2009. - 229(2). – Р. 323-330

50. Derera, N. F., Bhatt, G. M., McMaster, G. J. On the problem of preharvest sprouting of wheat / N. F. Derera, G. M. Bhatt, G. J. McMaster //Euphytica. – 1977. – Т. 26. – №. 2. – Р. 299-308 .

51. Dewey, D. R., Holmgren, A. H. Natural hybrids of Elymus cinereus X Sitanion hystrix / D. R. Dewey, A. H. Holmgren//Bulletin of the Torrey Botanical Club. – 1962. – Р. 217-228 .

52. Dewey, D. R. The genome structure of intermediate wheatgrass //Journal of Heredity. – 1962. – Т. 53. – №. 6. – Р. 282-290 .

53. Dewey, D. R. The genomic system of classification as a guide to intergeneric hybridization with the perennial Triticeae / D. R. Dewey //Springer US. - 1984. – Р. 209-279 .

54. Divashuk, M.G. The Association between the Allelic State of Vp-1B and Pre-harvest Sprouting Tolerance in Red-seeded Hexaploid Triticale / M.G .

Divashuk, N. Mayer, P.Y. Kroupin, V.S. Rubets, V.V. Pylnev, N. T. T. Lin,, G.I .

Karlov //Open Journal of Genetics. – 2012. – Т. 2. – №. 1. – Р. 51-55 .

Dvok, J., Ross, K., Mendlinger, S. Transfer of salt tolerance from 55 .

Elytrigia pontica (Podp.) Holub to wheat by the addition of an incomplete Elytrigia genome / J. Dvok, K. Ross, S. Mendlinger //Crop Science. – 1985. – Т. 25. – № .

2. – P. 306-309 .

56. Endo, T. R., Gill, B. S. The heterochromatin distribution and genome evolution in diploid species of Elymus and Agropyron / T. R. Endo, B. S. Gill //Canadian journal of genetics and cytology. – 1984. – Т. 26. – №. 6. – P. 669-678 .

57. Erkkila, M.J., Ahokas, H. Special barley b-amylase allele in a Finnish landrace line HA52 with high grain enzyme activity / M.J. Erkkila, H. Ahokas // Hereditas – 2001. - Vol.134 - P.91–95 .

58. Ezcurra, I. Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box / I. Ezcurra, P. Wycliffe, L. Nehlin, M. Ellerstrom, L .

Rask // Plant J. - 2000 – 24. – P. 2457–2466 .

59. Fan, X. Phylogenetic analysis among Hystrix, Leymus and its affinitive genera (Poaceae: Triticeae) based on the sequences of a gene encoding plastid acetyl-CoA carboxylase / X. Fan, H. Q. Zhang, L. N. Sha, L. Zhang, R. W .

Yang, C. B. Ding, Y. H. Zhou //Plant Science. – 2007. – Т. 172. – №. 4. – С. 701Farley, G., Adkins, S.W. An understanding of the physiology of cereal preharvest sprouting through dormancy studies on native grasses / G. Farley, S.W .

Adkins // 11th International Symposium on Pre-harvest Sprouting in Cereals. – 2007. – P. 19-19

61. Fedak, G. Wheat improvement using interspecific and intergeneric hybridization. In Scientific Principles of Yield Stability in Plant Production. / G .

Fedak // An International Symposium dedicated to the 90th anniversary of the founding of the V. Ya. Yurev Institute of Plant Production. (Kharkiv). - 2000 .

62. Fedorov, A. Mystery of intron gain / A. Fedorov, S. Roy, L. Fedorova, W. Gilbert //Genome research. – 2003. – Т. 13. – №. 10. – P. 2236-2241 .

63. Feng, D. S. High Molecular-Weight Glutenin Subunit Genes in Decaploid Agropyron elongatum / D. Feng, F. Chen, S. Zhao, G. M. Xia //Acta botanica sinica-english edition – 2004. – Т. 46. – №. 4. – P. 489-496 .

64. Finkelstein, R. and Lynch, T.J. The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor / R. Finkelstein, T.J .

Lynch // Plant Cell – 2000. - Vol.12. - P.599–609 .

65. Fiume, E. Introns are key regulatory elements of rice tubulin expression. / E. Fiume, P. Christou, S. Giani, D. Beviarion // Planta – 2004. Vol.218. - P.693–703 .

66. Flintham, J.E. Mapping genes for resistance to sprouting damage in wheat. / JE Flintham, R Adlam, M Bassoi, M Holdsworth, M. Gale // Euphytica – 2002. - Vol.126. - P.39–45

67. Flintham, J.E. Different genetic components control coat imposed and embryo-imposed dormancy in wheat. / J.E. Flintham // Seed Sci Res – 2000. Vol.10. - P.43–50 .

68. Fofana, B. Mapping quantitative trait loci controlling pre-harvest sprouting resistance in a red white seeded spring wheat cross / B. Fofana, D.G .

Humphreys, G. Rasul, S. Cloutier, A. Brl-Babel, S. Woods,. D.J. Somers //Euphytica. – 2009. – Т. 165. – №. 3. – P. 509-521 .

69. Footitt, S. Temperature, light and nitrate sensing coordinate Arabidopsis seed dormancy cycling, resulting in winter and summer annual phenotypes / S. Footitt, Z. Huang, H. A. Clay, A. Mead, W. E. FinchSavage //The Plant Journal. – 2013. – Т. 74. – №. 6. – P. 1003-1015 .

70. Friebe, B. C-banding and in-situ hybridization analyses of Agropyron intermedium, a partial wheat x Ag. intermedium amphiploid, and six derived chromosome addition lines / B. Friebe, Y Mukai., B. S. Gill, Y. Cauderon //Theoretical and Applied Genetics. – 1992. – Т. 84. – №. 7-8. – P. 899-905 .

71. Friebe, B. Characterization of wheat-alien translocations conferring resistance to diseases and pests: current status / B. Friebe, J. Jiang, W. J. Raupp, R .

A. McIntosh, B. S. Gill //Euphytica. – 1996. – Т. 91. – №. 1. – P. 59-87 .

Fu, D. Large deletion within the rst intron in VRN-1 are associated 72 .

with spring growth habit in barley and wheat. / D. Fu, P. Szucs, L. Yan, M .

Helguera, J.S. Skinner, J. von Zitzewitz, P.M. Hayes, J. Dubkovskii // Mol Genet Genomics – 2005. - Vol.273. - P.54–65 .

73. Gatford K.T. Novel resistance to pre-harvest sprouting in Australian wheat from the wild relative Triticum tauschii / K.T. Gatford, P .

Heamden, F. Ogbonnaya, R.F. Eastwood, G.M. Halloran // Euphytica. – 2002 .

– T.126, №1. – P.67-76

74. Gavazza, M. I. A. Methods for assessment of pre-harvest sprouting in wheat cultivars / M. I. A. Gavazza, M. C. Bassoi, T. C. D. Carvalho, J. C .

Bespalhok Filho, M. Panobianco //Pesquisa Agropecuria Brasileira. – 2012. – Т .

47. – №. 7. – P. 928-933 .

75. Gennaro, A., Koebner, R. M. D., Ceoloni, C. A. candidate for Lr19, an exotic gene conditioning leaf rust resistance in wheat / A. Gennaro, R. M. D .

Koebner, C. A. Ceoloni //Functional & integrative genomics. – 2009. – Т. 9. – № .

3. – P. 325-334 .

76. Giraudat, J. Isolation of the Arabidopsis ABI3 gene by positional cloning / J. Giraudat, B. M. Hauge, C. Valon, J. Smalle, F. Parcy, H. M. Goodman // Plant Cell/ - 1992. – 4. – P. 1251–1261 .

77. Gorham, J. Salt tolerance in the Triticeae: growth and solute accumulation in leaves of Thinopyrum bessarabicum / J. Gorham, E. McDonnell, E. Budrewicz, R. W. Jones //Journal of Experimental Botany. – 1985. – Т. 36. – №. 7. – С. 1021-1031 .

78. Grimault, A. Role of B3 domain transcription factors of the AFL family in maize kernel filling / A. Grimault,, G. Gendrot, S. Chaignon, F. Gilard, G. Tcherkez, J. Thvenin, P.M. Rogowsky //Plant Science. – 2015. – Т. 236. – С .

116-125 .

79. Groos, C. of the relationship between pre-harvest sprouting and grain color by quantitative trait loci analysis in a white red grain bread-wheat cross. / C. Groos, G. Gay, M.R. Perretant, L. Gervais, M. Bernald, F. Dedryver, G .

Charmet // Theor. Appl. Genet. – 2002. - Vol.104. - P.39–47 .

80. Guo, J. High-density mapping of the major FHB resistance gene Fhb7 derived from Thinopyrum ponticum and its pyramiding with Fhb1 by markerassisted selection / J. Guo, X. Zhang, Y. Hou, J. Cai, X. Shen, T. Zhou, F. Han //Theoretical and Applied Genetics. – 2015. – Т. 128. – №. 11. – P. 2301-2316 .

81. Guo, X. The rice GERMINATION DEFECTIVE 1, encoding a B3 domain transcriptional repressor, regulates seed germination and seedling development by integrating GA and carbohydrate metabolism / X. Guo, X. Hou, J .

Fang, P. Wei, B. Xu, M. Chen, C. Chu //The Plant Journal. – 2013. – Т. 75. – №. 3 .

– P. 403-416 .

82. Han, F. Genomic constitution and variation in five partial amphiploids of wheat–Thinopyrum intermedium as revealed by GISH, multicolor GISH and seed storage protein analysis / F. Han, B. Liu, G. Fedak, Z. Liu //Theoretical and applied genetics. – 2004. – Т. 109. – №. 5. – P. 1070-1076 .

83. Hang, A., Bockelman, H.E., Burton, C.S. Cytological and seed morphological investigation of 250 accessions from the WJ sando collection / A .

Hang, H.E. Bockelman, C.S. Burton // Agronomy Society of America, Crop Science Society of America, Soil Science Society of America Meeting. – 2005. – P. 6-10 .

84. Harlan, J.R.. Genetic conservation of plants that feed the world / J.R .

Harlan // Environmental Journal. – 1972. – 46. – P. 15-17 .

85. He, F. Biosynthesis and genetic regulation of proanthocyanidins in plants / F. He, Q. H. Pan, Y. Shi, C. Q. Duan //Molecules. – 2008. – Т. 13. – № .

10. – P. 2674-2703 .

Hernndez, P., Martn, A., Dorado, G. Development of SCARs by 86 .

direct sequencing of RAPD products: a practical tool for the introgression and marker-assisted selection of wheat / P. Hernndez, A. Martn, G. Dorado //Molecular Breeding. – 1999. – Т. 5. – №. 3. – P. 245-253 .

87. Hill, A. A conserved domain of the viviparous-1 gene product enhances the DNA binding activity of the bZIP protein EmBP-1 and other transcription factors / A. Hill, A. Nantel, C. D. Rock, R. S. Quatrano //Journal of Biological Chemistry. – 1996. – Т. 271. – №. 7. – С. 3366-3374 .

88. Himi, E. Effect of grain colour gene (R) on grain dormancy and sensitivity of the embryo to abscisic acid (ABA) in wheat. / E Himi, DJ Mares, A Yanagisawa, K. Noda // J Exp Bot – 2002. - Vol. 53. - P. 569–1574 .

89. Himmelbach, A., Yang, Y., Grill, E. Relay and control of abscisic acid signaling / A. Himmelbach, Y. Yang, E. Grill // Curr. Opin. Plant Biol. – 2003. – 6 .

– P. 470– 479 .

90. Hitchcock, A. S. Manual of the grasses of the United States / A. S .

Hitchcock // Courier Corporation. - 1971. – Т. 2 .

91. Hobo, T., Kowyama, Y., Hattori, T.A. bZIP factor, TRAB1, interacts with VP1 and mediates abscisic acid-induced transcription / T. Hobo, Y .

Kowyama, T. A. Hattori // Proc. Natl. Acad. Sci. USA 96 – 1999. - P.15348– 15353 .

92. Hoecker, U., Vasil, I. K., McCarty, D. R. Integrated control of seed maturation and germination programs by activator and repressor functions of Viviparous-1 of maize / U. Hoecker, I. K. Vasil, D. R. McCarty //Genes & development. – 1995. – Т. 9. – №. 20. – С. 2459-2469 .

93. Hoecker, U., Vasil, I. K., and McCarty, D. R. Signaling from the embryo conditions Vp1-mediated repression of alpha-amylase genes in the aleurone of developing maize seeds / U. Hoecker, I. K. Vasil, D. R. McCarty // Plant J. – 1999. – 19. – P. 371–377 .

94. Hohmann, U. Molecular cytogenetic analysis of Agropyron chromatin specifying resistance to barley yellow dwarf virus in wheat / U. Hohmann, W .

Busch, K. Badaeva, B. Friebe, B. S. Gill //Genome. – 1996. – Т. 39. – №. 2. – P .

336-347 .

95. Hussein Z. Gene expression analysis in the roots of salt-stressed wheat and the cytogenetic derivatives of wheat combined with the salt-tolerant wheatgrass, Lophopyrum elongatum / Z. Hussein, A. Dryanova, D. Maret, P. J .

Gulick //Plant cell reports. – 2014. – Т. 33. – №. 1. – P. 189-201 .

96. Hutchinson, J., Miller, T. E., Reader, S. M. C-banding at meiosis as a means of assessing chromosome affinities in the Triticeae / J. Hutchinson, T.E .

Miller, S.M. Reader //Canadian journal of genetics and cytology. – 1983. – Т. 25. – №. 4. – P. 319-323 .

97. Imtiaz, M., Ogbonnaya, F.C., Oman, J., van Ginkel, M .

Characterization of quantitative trait loci controlling genetic variation for preharvest sprouting in synthetic backcross-derived wheat lines / M. Imtiaz, F.C .

Ogbonnaya, J. Oman, M. van Ginkel // Genetics – 2008. - Vol. 178. - P. 1725– 1736 .

98. Jacobsen, J. V., Close, T. J. Control of transient expression of chimaeric genes by gibberellic acid and abscisic acid in protoplasts prepared from mature barley aleurone layers / J.V. Jacobsen, T.J. Close //. Plant Mol. Biol. – 1991.- 16. – P. 713–724 .

99. Jaikumar, N. S. Agronomic assessment of perennial wheat and perennial rye as cereal crops / N. S. Jaikumar, S. S. Snapp, K. Murphy, S. S. Jones //Agronomy Journal. – 2012. – Т. 104. – №. 6. – С. 1716-1726 .

100. Jauhar, P., Joppa, L. Chromosome pairing as a tool in genome analysis: merits and limitation / P. Jauhar, L. Joppa //Methods of genome analysis in plants CRC Press, Boca Raton. – 1996. – Т. 21 .

101. Jauhar, P. P. Multidisciplinary approach to genome analysis in the diploid species, Thinopyrum bessarabicum and Th. elongatum (Lophopyrum elongatum), of the Triticeae / P. P. Jauhar //Theoretical and applied genetics. – 1990. – Т. 80. – №. 4. – С. 523-536 .

102. Jenkins, B. C., Mochizuki A. A new amphiploid from a cross between Triticum durum and Agropyron elongatum – 1957 .

103. Ji, H. S., Chu, S. H., Jiang, W. Characterization and mapping of a shattering mutant in rice that corresponds to a block of domestication genes / H. S .

Ji, S. H. Chu, W. Jiang // Genetics – 2006 – 173. – P. 995-1005 .

104. Jiang, J., Gill, B. S. New 18S· 26S ribosomal RNA gene loci:

chromosomal landmarks for the evolution of polyploid wheat / J. Jiang, B.S. Gill //Chromosoma. – 1994. – Т. 103. – №. 3. – P. 179-185 .

105. Jiang, J., Friebe, B., Gill, B. S. Recent advances in alien gene transfer in wheat / J. Jiang, B. Friebe, B.S. Gill //Euphytica. – 1993. – Т. 73. – №. 3. – P .

199-212 .

106. Jonah, P. M. Review: The importance of molecular markers in plant breeding programmes /, P.M. Jonah, L.L. Bello, O. Lucky, A. Midau, S.M .

Moruppa //Global Journal of Science Frontier Research. – 2011. – Т. 11. – №. 5 .

107. Jones, H. D. Identification and analysis of proteins that interact with the Avena fatua homologue of the maize transcription factor VIVIPAROUS 1 / H .

D. Jones, S. Kurup, N. C. Peters, M. J. Holdsworth //The Plant Journal. – 2000. – Т. 21. – №. 2. – P. 133-142 .

108. Joshi, S.P Molecular markers in plant genome analysis /S.P. Joshi, K .

Prabhakar, P.K Ranjekar, V.S. Gupta // CURRENT SCIENCE. – 1999. – P. 1-19

109. Kang, H.Y. Production of intergeneric hybrid between dwarfing polish wheat (Triticum polonicum L.) and Aegilops tauschii Cosson. with reference to wheat origin / H.Y. Kang, Y. Wang, H.J. Yuan, Y. Jiang, Y.H. Zhou // Russian Journal of Genetics, 2009. – Vol 45. - N 6. – P. 671-677 .

110. Kato, K. Detection of loci controlling seed dormancy on group 4 chromosomes of wheat and comparative mapping with rice and barley genomes. / K Kato, W Nakamura, T Tabiki, H Miura, S. Sawada // Theor Appl Genet – 2001 .

- Vol. 102. - P.980–985 .

111. Kellogg, E.A., Appels, R., Mason-Gamer, R.J. When genes tell different stories: The diploid genera of Triticeae (Gramineae) / E.A. Kellogg, R .

Appels, R.J. Mason-Gamer // Systematic Botany. – 1996. – V. 21. – P. 321-347 .

112. Kellogg, E. A. Evolutionary history of the grasses / E.A. Kellogg //Plant physiology. – 2001. – Т. 125. – №. 3. – P. 1198-1205

113. Kihara, H. Genom analyse bei Triticum und Aegilops / H. Kihara // Cytologia. – 1930. – Т. 1. – №. 3. – P. 263-284 .

114. King R.W. Water uptake in relation to pre-harvest sprouting damage in wheat: grain characteristics / R. King, R. W // Australian Jounal of Agricultural Resesearch. – 1984. - Vol. 36. - P. 337–345 .

115. King, R. Water uptake in relation to pre-harvest sprouting damage in wheat: ear characteristics / R. King, R. Richards // Australian Journal of Agricultural Research. — 1984. — Vol. 35, N 3. — P. 327–336 .

116. Kishii, M., Wang, R.R.C., Tsujimoto, H. GISH analysis revealed new aspect of genomic constitution of Thinopyrum intermedium / M. Kishii, R.R.C .

Wang, H. Tsujimoto // Czech J. Genet. Plant Breed. - 2005. – P. 92-95 .

117. Kobiljski B. et al. Molecular markers and wheat breeding. – 2007

118. Kong, L. Water-soluble phenolic compounds in the coat control germination and peroxidase reactivation in Triticum aestivum seeds / L. Kong, F .

Wang, J. Si, B. Feng, S. Li // Plant Growth Regulation. - 2008. - Vol. 56. - P. 275Kottearachchi, N. S. Increased grain dormancy in white-grained wheat by introgression of preharvest sprouting tolerance QTLs / N.S. Kottearachchi, N .

Uchino, K. Kato, H. Miura //Euphytica. – 2006. – Т. 152. – №. 3. – С. 421-428 .

120. Kruger, J.E. Biochemistry of pre-harvest sprouting in cereals. In N.F .

Derera, ed. Pre-Harvest Field Sprouting / J.E. Kruger // in Cereals. CRC Press, Inc., Boca Raton, Florida, U.S.A. - 1989. - P. 61-84 .

121. Kulwal P. Association mapping for pre-harvest sprouting resistance in white winter wheat / P. Kulwal, G. Ishikawa, D. Benscher, Z. Feng, L. X. Yu, A .

Jadhav, M. E. Sorrells //Theoretical and Applied Genetics. – 2012. – Т. 125. – № .

4. – P. 793-805 .

122. Kulwal, P.L. Mapping of a major QTL for pre-harvest sprouting tolerance on chromosome 3A in bread wheat / P.L. Kulwal, N. Kumar, A. Gaur, P .

Khurana, J.P. Khurana, A.K. Tyagi, H.S. Balyan, P.K. Gupta // Theor Appl Genet .

– 2005. – Vol. 111(6). – P. 1052-1059 .

123. Kushiro, T. The Arabidopsis cytochrome P450 CYP707A encodes ABA 8’-hydroxylases: key enzymes in catabolism / T. Kushiro, M. Okamoto, K .

Nakabayashi, K. Yamagishi, S. Kitamura, T. Asami, N. Hirai, T. Koshiba, Y .

Kamiya, E. Nambara // EMBO J. – 2004/ - 23. – P. 1647–1656 .

124. Li, C.D. Genes controlling seed dormancy and pre-harvest sprouting in a rice–wheat–barley comparison / C.D. Li, PX Ni, M Francki, A Hunter, Y Zhang, D Schibed, H Li, A Tarr, J Wang, M Cakir, J Yu, M Bellgard, R Lance, R .

Appels // Funct Integr Genomics. – 2004. - Vol. 4. - P. 84–93 .

125. Li, D. Genetic relationships among five basic genomes St, E, A, B and D in Triticeae revealed by genomic southern and in situ hybridization / D. Li, X .

Zhang // Journal of Integrative Plant Biology. – 2007. – Vol. 49. (7) – P. 1080 – 1086 .

126. Li, X. J. Identification of a novel wheat-Thinopyrum ponticum addition line revealed with cytology, SSR, EST-SSR, EST-STS and PLUG markers / X.J. Li, X.G. Hu, T. Z. Hu, G. Li, Z.G. Ru, L.L. Zhang, Y.M. Lang //Cereal Research Communications. – 2015. – Т. 43. – №. 4. – P. 544-553 .

127. Liang, G. H. Registration of B-6-37-1 Wheat Germplasm1 (Reg. No .

GP 118) / G.H. Liang, R.C. Wang, C. L. Niblett, E.G. Heyne //Crop Science. – 1979. – Т. 19. – №. 3. – P. 421-421 .

128. Lin, R., Horsley, R.D., Schwarz, P.B. Methods to determine dormancy and preharvest sprouting resistance in barley / R. Lin, R.D. Horsley, P.B. Schwarz // Crop Sci. – 2009. - 49. – P. 831-840 .

129. Liu, L. Allelic variation at the Glu-1 and Glu-3 loci, presence of the 1B. 1R translocation, and their effects on mixographic properties in Chinese bread wheats / L. Liu, Z. He, J. Yan, Y. Zhang, X. Xia, R. J. Pea //Euphytica. – 2005. – Т. 142. – №. 3. – P. 197-204 .

130. Liu, S., Bai, G. Dissection and fine mapping of a major QTL for preharvest sprouting resistance in white wheat Rio Blanco / S. Liu, G. Bai //Theoretical and applied genetics. – 2010. – Т. 121. – №. 8. – С. 1395-1404 .

131. Liu, S., Chao, S., Anderson, J. A. New DNA markers for high molecular weight glutenin subunits in wheat / S. Liu, S. Chao, J. A. Anderson //Theoretical and Applied Genetics. – 2008. – Т. 118. – №. 1. – P. 177-183 .

132. Liu, S., Gao, X., Xia, G. Characterizing HMW-GS alleles of decaploid Agropyron elongatum in relation to evolution and wheat breeding / S. Liu, X. Gao, G. Xia //Theoretical and Applied Genetics. – 2008. – Т. 116. – №. 3. – С. 325-334 .

133. Liu, Q. Phylogenetic relationships in Elymus (Poaceae: Triticeae) based on the nuclear ribosomal internal transcribed spacer and chloroplast trntL-F sequences / Q. Liu, S. Ge, H. Tang, Z. Zhang, G. Zhu, B.-R. Lu // New Phytologist. -2005. – V.170. – P. 411-420 .

134. Lohwasser, U., Rder, M. S., Brner, A. QTL mapping of the domestication traits pre-harvest sprouting and dormancy in wheat (Triticum aestivum L.) / U. Lohwasser, M. S. Rder, A. Brner //Euphytica. – 2005. – Т .

143. – №. 3. – P. 247-249 .

135. Lve, A. Conspectus of the Triticeae / A. Lve // Feddes Repertorium, 1984. – 95 – P. 425–521 .

136. Mahelka, V., Kopeck, D., Patov, L. On the genome constitution and evolution of intermediate wheatgrass (Thinopyrum intermedium: Poaceae, Triticeae) / V. Mahelka, D. Kopeck, L. Patov // BMC evolutionary biology. – 2011. – Т. 11. – №. 1. – P. 1 .

137. Mares, D.J., Oettler, G. -amylase activity in developing triticale grains / D.J. Mares, G. Oettler // J. Cer. Science. – 1991. - №13. – P.151-160 .

138. Mares, D.J. Dormancy in white wheat: mechanism and location of genes / D.J. Mares // Center for Academic Societies, Japan. – 1996. - P. 179–184 .

139. Mares, D.J. QTL located on chromosome 4A associated with dormancy in white- and redgrained wheats of diverse origin / DJ Mares, K Mrva, J Cheong, K Williams, B Watson, E Storlie, M Sutherland, Y A. Zou // Theor Appl Genet. – 2005. - Vol. 111. - P. 1357–1364 .

140. Martynov, S.P., Dobrotvorskaya, T.V., Pukhalskiy, V. A. Dynamics of Genetic Diversity in Winter Common Wheat Triticum aestivum L. Cultivars Released in Russia from 1929 to 2005 / S.P. Martynov, T.V. Dobrotvorskaya, V .

A. Pukhalskiy // Russian Journal of Genetics. - 2006. - Vol. 42. - No. 10. - P .

1137–1147 .

141. Matsumura, S. Other studies on wheats / S. Matsumura //Annual Report of the National Institute of Genetics, Japan. – 1949. – Т. 50. – №. 1. – P .

25-27 .

142. McCarty, D.R. Molecular analysis of viviparous-1: An abscisic acidinsensitive mutant of maize / D.R. McCarty, C.B. Carson, P.S. Stinard, D.S .

Robertson // Plant Cell. – 1989. - Vol. 1(5). - P. 523–532 .

143. McCarty, D.R. The Viviparous-1 developmental gene of maize encodes a novel transcriptional activator / D.R. McCarty, T Hattori, CB Carson, V Vasil, M Lazar, IK. Vasil // Cell. – 1991. - Vol. 66. - P. 895–905 .

144. McDonald, M. P. Evaluation of Lophopyrum elongatum as a source of genetic diversity to increase the waterlogging tolerance of hexaploid wheat (Triticum aestivum) / M.P. McDonald, N.W. Galwey, P. EllneskogStaam, T. D .

Colmer //New phytologist. – 2001. – Т. 151. – №. 2. – P. 369-380 .

145. McIntosh, R.A., Devos, K.M., Dubcovsky, J., Rogers, W.J., Morris, C.F., Appels, R., Somers, D.J. and Anderson, O.A. Catalogue of gene symbols for wheat // Supplement.- 2009 .

146. McKibbin, R. S. Transcripts of Vp-1 homeologues are misspliced in modern wheat and ancestral species / R.S. McKibbin, M.D. Wilkinson, P.C .

Bailey, J.E. Flintham, L.M. Andrew, P.A. Lazzeri, M.D. Gale, J.R. Lenton, M.J .

Holdsworth // Proc. Natl. Acad. Sci. USA. – 2002. – 99. – P. 10203–10208 .

147. Ming-Shan, Y. Development of specific SSR marker for E genome of Thinopyrum spp. using wheat microsatellites / Y. Ming-Shan, L. Bao-Yun, T. ZhiHui, T. Zhao-Hui, L. Shou-Bin, L. Guang-Tian //Chinese Journal of Agricultural Biotechnology. – 2004. – Т. 1. – №. 03. – С. 143-148 .

148. Mirzaghaderi, G. Cytogenetic analysis of hybrids derived from wheat and Tritipyrum using conventional staining and genomic in situ hybridization / G .

Mirzaghaderi, G. Karimzadeh, H. S. Hassani, M. Jalali-Javaran, A. Baghizadeh //Biologia Plantarum. – 2010. – Т. 54. – №. 2. – P. 252-258 .

149. Mohan, A. Genome-wide QTL analysis for pre-harvest sprouting tolerance in bread wheat / A. Mohan, P. Kulwal, R. Singh, V. Kumar, R.R. Mir, J .

Kumar, M. Prasad, H. S. Balyan, P.K. Gupta // Euphytica. – 2009. – 168 (3). – P .

319-329 .

150. Mori, M. Mapping QTLs for grain dormancy on wheat chromosome 3A and the group 4 chromosomes, and their combined effect / M. Mori, N. Uchino, M. Chono, K. Kato, H. Miura// Theoret. Appl. Genet. – 2005. - Vol. 110. - P .

1315–1323 .

151. Moustakas, M., Symeonidis, L., Ouzounidou, G. Genome relationships in the Elytrigia group of the genusAgropyron (Poaceae) as indicated by seed protein electrophoresis / M. Moustakas, L. Symeonidis, G. Ouzounidou //Plant systematics and evolution. – 1988. – Т. 161. – №. 3-4. – P. 147-153 .

152. Mrva, K. and Mares, D. J. Quantitative trait locus analysis of late maturity -amylase in wheat using the doubled haploid population Cranbrook Halberd / K. Mrva and D. J. Mares// Aust. J. Agric. Res. – 2001. - Vol. 52. - P .

1267–1273 .

153. Mujeeb-Kazi, A. Production and cytogenetics of a new Thinopyrum elongatum/Triticum aestivum hybrid, its amphiploid and backcross derivatives / A .

Mujeeb-Kazi, A. Cortes, A. Gul, M. Farooq, F. Majeed, I. Ahmad, R. Delgad //Pak. J. Bot. – 2008. – Т. 40. – №. 2. – P. 565-579 .

154. Munkvold, J. D. Mapping quantitative trait loci for preharvest sprouting resistance in white wheat / J.D. Munkvold, J. Tanaka, D. Benscher, M.E .

Sorrells //Theoretical and applied genetics. – 2009. – Т. 119. – №. 7. – P. 1223Nakamura, S. and Toyama, T. Isolation of a VP1 homologue from wheat and analysis of its expression in embryos of dormant and non-dormant cultivars / S. Nakamura, T. Toyama // J. Exp. Bot. – 2001. – 52. – P. 875–876 .

156. Nielsen, M. T. Effect of weather variables during maturation on preharvest sprouting of hard white wheat / M.T. Nielsen, A.J. McCrate, E.G .

Heyne, G. M. Paulsen //Crop science. – 1984. – Т. 24. – №. 4. – P. 779-782 .

157. Novosel'skaia-Dragovich, A. I. Comparative analysis of the genetic diversity dynamics at gliadin loci in the winter common wheat Triticum aestivum L. cultivars developed in Serbia and Italy over 40 years of scientific breeding /A .

Y. Novoselskaya-Dragovich, A. V. Fisenko, A.G. Imasheva, V.A. Pukhalskiy //Genetika. – 2007. – Т. 43. – №. 11. – P. 1478-1485 .

158. Ochoa, V. Molecular and cytogenetic characterization of a common wheat-Agropyron cristatum chromosome translocation conferring resistance to leaf rust / V. Ochoa, E. Madrid, M. Said, D. Rubiales, A. Cabrera //Euphytica. – 2015 .

– Т. 201. – №. 1. – P. 89-95 .

159. Ogbonnaya, F.C. Identification of novel gene for seed dormancy in

wheat / FC Ogbonnaya, M Imtiaz, P Hearnden, J Wilson, RF Eastwood // In:

Proceedings of the 13th Australasian Plant Breeding Conference, Christchurch, New Zealand. – 2006 .

160. Ogbonnaya, F.C. Genetic and QTL analyses of seed dormancy and preharvest sprouting resistance in the wheat germplasm CN10955 / FC Ogbonnaya, M Imtiaz, G Ye, PR Hearnden, E Hernandez, RF Eastwood, M Van Ginkel, SC Shorter, JM. Winchester // Theor Appl Genet. – 2008. - Vol. 116. - P .

891–902 .

161. Ortiz, R. Climate change: Can wheat beat the heat? / R. Ortiz, K. D .

Sayre, B. Govaerts, R. Gupta, G.V. Subbarao, T. Ban, D. Hodson, J. M. Dixon, J .

I. Ortiz-Monasterio, M. Reynolds // Agriculture, Ecosystems & Environment/ Vol. 126, Issues 1-2. - P. 46-58 .

162. Osa, M. Mapping QTLs for seed dormancy and the Vp1 homologue on chromosome 3A in wheat / M Osa, K Kato, M Mori, C Shindo, A Torada, H Miura // Theor Appl Genet. – 2003. - Vol. 106. - P. 1491–1496. .

163. Osborne, D. J. Dormancy as a survival stratagem / D.J. Osborne //Annals of Applied Biology. – 1981. – Т. 98. – №. 3. – P. 525-531 .

164. Paterson, A.H., Sorrells, M.E., Obendorf, R.L. Methods of evaluation for preharvest sproutiong resistance in wheat breeding programs / AH Paterson, ME Sorrells, R.L. Obendorf // Can J Plant Sci. – 1989. - Vol. 69. - P. 681–689 .

165. Paek, N. C. Inhibition of germination gene expression by Viviparousand ABA during maize kernel development / N.C. Paek, B.M. Lee, B.D. Gyu, J .

D. Smith //Molecules and cells. – 1998. – Т. 8. – №. 3. – P. 336-342 .

166. Peto, F. H. Hybridization of Triticum and Agropyron: Ii. Cytology of the male parents and F 1 generation / F.H. Peto //Canadian Journal of Research. – 1936. – Т. 14. – №. 5. – P. 203-214 .

167. Pienaar, R. V. Wheat Thinopyrum hybrids / R.V. Pienaar //Wheat – Springer Berlin Heidelberg. - 1990. – С. 167-217 .

168. Pistn, F. Down-regulating -gliadins in bread wheat leads to nonspecific increases in other gluten proteins and has no major effect on dough gluten strength / F. Pistn, J. Gil-Humanes, M. Rodrguez-Quijano, F. Barro //PLoS One .

– 2011. – Т. 6. – №. 9. – P. 24754 .

169. Pogna, N. E. Evaluation of nine Perennial / N. E. Pogna, E. Galassi, R .

Ciccoritti, E. De Stefanis, D. Sgrulletta, P. Cacciatori, A. Bozzini // Perennial crops for food security. – 2014. – P. 54 .

170. Prins, R. AFLP and STS tagging of Lr19, a gene conferring resistance to leaf rust in wheat / R. Prins, J.Z. Groenewald, G.F. Marais, J.W. Snape, R.M.D .

Koebner //Theoretical and Applied Genetics. – 2001. – Т. 103. – №. 4. – P. 618Rasul, G. Mapping QTLs for pre-harvest sprouting traits in the spring wheat cross ‘RL4452/AC Domain’ / G. Rasul, D.G. Humphreys, A. Brule-Babel, C.A. McCartney, R.E. Knox, R.M. DePauw, D.J. Somers //Euphytica. – 2009. – Т .

168. – №. 3. – P. 363-378 .

172. Rathjen, J. R., Mares, D. J., Strounina, E. V. Pathway for water movement into dormant and non-dormant wheat (Triticum aestivum L.) grains / JR Rathjen, D J Mares, E V. Strounina // 11th International Symposium on Preharvest Sprouting in Cereals.– 2007 .

173. Richardson K. Potential new sources of wheat curl mite resistance in wheat to prevent the spread of yield-reducing pathogens / K. Richardson, A.D .

Miller, A.A. Hoffmann, P. Larkin //Experimental and Applied Acarology. – 2014 .

– Т. 64. – №. 1. – P. 1-19 .

174. Roschzttardtz, H. A nuclear gene encoding the iron-sulfur subunit of mitochondrial complex II is regulated by B3 domain transcription factors during seed development in Arabidopsis / H. Roschzttardtz, I. Fuentes, M. Vsquez, C .

Corvaln, G. Len, I. Gmez, X. Jordana //Plant physiology. – 2009. – Т. 150. – №. 1. – P. 84-95 .

175. Ruz, M. A. Comportamiento ecofisiolgico del tricepiro (X Triticosecale Wittmack x X Agrotriticum Ciferri & Giacom) en relacin a Triticale (X Triticosecale Wittmack) y Trigopiro (X Agrotriticum Ciferri & Giacom)/. – 2009 .

176. Rumajun, A. Identification of a Potential Source of Complete Resistance to Soilborne Wheat Mosaic Virus in a WheatThinopyrum Intermedium Addition Line / A. Rumajun, J. Jahter, M. Trottet, H. Lapierre //Journal of Phytopathology. – 1996. – Т. 144. – №. 3. – P. 135-138 .

177. Schachermayr, G. M. Identification and localization of molecular linked to the Lr9 leaf rust resistance gene of wheat / G. M. Schachermayr, H .

Siedler, M.D. Gale, H. Winzeler, M. Winzeler, B. Keller // Theor. Appl. Genet. – 1994. – Vol. 88. – P. 110-115 .

178. Schultz, T. F. 14-3-3 proteins are part of an abscisic acid– VIVIPAROUS1 (VP1) response complex in the Em promoter and interact with Vp1 and EmBP1 / T. F. Schultz, J. Medina, A. Hill, R. S. Quatrano // The Plant Cell. – 1998. – Т. 10. – №. 5. – P. 837-847 .

179. Seberg, O., Frederiksen, S. A phylogenetic analysis of the monogenomic Triticeae (Poaceae) based on morphology / O. Seberg, S .

Frederiksen //Botanical Journal of the Linnean Society. – 2001. – Т. 136. – №. 1. – P. 75-97 .

180. Sharma, H. C., Benlhabib, O., Ohm, H. W. Anther culture and chromosome reduction in wheat Thinopyrum wide crosses / H. C. Sharma, O .

Benlhabib, H. W. Ohm //Plant cell, tissue and organ culture. – 1999. – Т. 57. – № .

3. – P. 215-218 .

181. Sharma, H. Introgression and characterization of barley yellow dwarf virus resistance from Thinopyrum intermedium into wheat / H. Sharma, H. Ohm, L. Goulart, R. Lister, R. Appels, O. Benlhabib // Genome. – 1995. – V. 38. – P .

406-413 .

182. Shen, Q. Dissection of abscisic acid signal transduction pathways in barley aleurone layers / Q. Shen, A. Gomez-Cadenas, P. Zhang, M.K. WalkerSimmons, J. Sheen, T.H.D. Ho //Plant molecular biology. – 2001. – Т. 47. – №. 3 .

– P. 437-448 .

183. Shen, W. The Salt Stress-Inducible Protein Kinase Gene, Esi47, from the Salt-Tolerant Wheatgrass Lophopyrum elongatum Is Involved in Plant Hormone Signaling / W. Shen, A. Gmez-Cadenas, E.L. Routly, T.H.D. Ho, J.A .

Simmonds, P.J. Gulick //Plant Physiology. – 2001. – Т. 125. – №. 3. – P. 1429Shen, X. K. Identification and genetic mapping of the putative Thinopyrum intermedium-derived dominant powdery mildew resistance gene PmL962 on wheat chromosome arm 2BS / X.K. Shen, L.X. Ma, S.F. Zhong, N .

Liu, M. Zhang, W.Q. Chen, G.H. Bai //Theoretical and Applied Genetics. – 2015 .

– Т. 128. – №. 3. – P. 517-528 .

185. Sherman J.D. Identification of barley genome segments introgressed into wheat using PCR markers / J.D. Sherman, L.Y. Smith, Т.К. Blake, L.E .

Talbert // Genome. – 2001. – Vol. 44. – P. 38-44 .

186. Shiota, H. C-ABI3, the carrot homologue of the Arabidopsis ABI3, is expressed during both zygotic and somatic embryogenesis and functions in the regulation of embryo-specific ABA-inducible genes / H. Shiota, R. Satoh, K .

Watabe, H. Harada, H. Kamada // Plant Cell Physiol. – 1998. – 39. – P. 1184– 1193 .

187. Siahsar, B. Evaluation of genetic diversity of tritipyrum, triticale and wheat lines through RAPD and ISJ markers / B. Siahsar, M. Allahdoo, H. S .

Hasani //Iranian Journal of Field Crop Science. – 2010. – Т. 41. – №. 3. – С. 555Simpson, G. M. Seed Dormancy in Grasses / G.M. Simpson // Cambridge Univ. Press, Cambridge. - 1990. – P. 282 .

189. Sjakste, T.G., Zhuk, A.F. Novel haplotype description and structural background of the eventual functional signi-cance of the barley b-amylase gene intron III rearrangements / TG Sjakste, AF. Zhuk // Theor Appl Genet. – 2006. Vol.113. - P.1063–1079 .

190. Skovmand, B. Wheat genetic resources / B. Skovmand, S. Rajaram, J.M. Ribaut, A.R. Hede // Bread Wheat. Improvement and Production. Edited by B.C. Curtis. – Food and Agriculture Organization of the United Nations. – Rome,

2002. Режим доступа: http://www.fao.org/DOCREP/006/Y4011E/y4011e08.htm

191. Smith, R.L., Schweder, M.E., Barnett, R.D. Identification of glutenin alleles in wheat and triticale using PCR-generated DNA markers / R.L. Smith, M.E. Schweder, R.D. Barnett // Crop Sc. - Vol.35, №5. – P. 1373 – 1378 .

192. Snapp, S., Price, R., Morton, M. Seed priming of winter annual cover crops improves germination and emergence / S. Snapp, R. Price, M. Morton //Agronomy journal. – 2008. – Т. 100. – №. 5. – P. 1506-1510 .

193. Sorrells, M.E., Anderson, J.A. Quantitative trait loci associated with preharvest sprouting in white wheat. In: Noda K, Mares DJ (eds) Preharvest sprouting in cereals 1995 / ME Sorrells, JA. Anderson // Center for Academic Societies, Japan. - 1996. - P.137–142 .

194. Stebbins Jr, G. L., Pun, F. T. Artificial and natural hybrids in the Gramineae, tribe Hordeae. V. Diploid hybrids of Agropyron / G.L. Stebbins Jr, F.T. Pun //American Journal of Botany. – 1953. – P. 444-449 .

195. Sun, S. The approach and methods of breeding new varieties and new species from Agrotriticum hybrids / S. Sun // Acta. Agron. Sin. - 1981. – 7. – P .

51-58 .

196. Sun, X. Characterization of the HMW glutenin subunits from Aegilops searsii and identification of a novel variant HMW glutenin subunit / X .

Sun, S. Hu, X. Liu, W. Qian, S. Hao, A. Zhang, D.Wang //Theoretical and applied genetics. – 2006. – Т. 113. – №. 4. – P. 631-641 .

197. Suzuki, M., Kao, C.Y., Mctarty, D.R. The conserved B3 domain of VIVIPAROUS1 has a cooperative DNA binding activity / M Suzuki, CY Kao, DR .

Mctarty // Plant Cell. - 1997. - Vol.9. - P.799–807 .

198. Suzuki, M., McCarty, D. R. Functional symmetry of the B3 network controlling seed development / M. Suzuki, D.R. McCarty //Current opinion in plant biology. – 2008. – Т. 11. – №. 5. – P. 548-553 .

199. TabaeiAghdaei, S. R., Harrison, P., Pearce, R. S. Expression of dehydrationstressrelated genes in the crowns of wheatgrass species [Lophopyrum elongatum (Host) A. Love and Agropyron desertorum (Fisch. ex Link.) Schult.] having contrasting acclimation to salt, cold and drought / S.R. TabaeiAghdaei, P .

Harrison, R.S. Pearce //Plant, Cell & Environment. – 2000. – Т. 23. – №. 6. – P .

561-571 .

200. Tang, S. Genomic in situ hybridization (GISH) analyses of Thinopyrum intermedium, its partial amphiploid Zhong 5, and diseaseresistant derivatives in wheat / S. Tang, Z. Li, X. Jia, P.J. Larkin // Theor Appl Genet. – 2000. – V. 100. – P. 344-352 .

201. Tang, Z. X. A new long terminal repeat (LTR) sequence allows to identify J genome from JS and St genomes of Thinopyrum intermedium / Z. X .

Tang, Z. J. Yang, S. L. Fu, M. Y. Yang, G. R. Li, H. Q. Zhang, F. Q. Tan, R .

Zhenglong // J Appl Genetics. - 2011. – 52. –P. 31–33 .

202. Thottappilly, G. The use of DNA markers for rapid improvement of crops in Africa / G. Thottappilly, H.D. Mignouna, O.G. Omitogun //African Crop Science Journal. – 2000. – Т. 8. – №. 1. – P. 99-108 .

203. Tsitsin, N.V. New species and varieties of wheats / N.N. Tsitsin // Byulleten Glavnogo Botanicheskogo Sada AN SSSR. – 1960. – 38. – P. 38–41 .

204. Tsvelev, N. 1973. Conspectus specierum tribus Triticeae Dum .

familiae Poaceae in flora URSS /, N. Tsvelev // Novosti Systematiki Vysshikh Rastenii. – 1973. – 10. – P. 19–59 .

205. Tyrka, M., Chekowski, J. Enhancing the resistance of triticale by using genes from wheat and rye / M. Tyrka, J. Chekowski // J. Appl. Genet. – 2004. – 5(3) – P. 283–295 .

206. Ullrich, S.E. Genetic analysis of preharvest sprouting in six-row barley cross / SE Ullrich, JA Clancy, IA del Blanco, H Lee, VA Jitkov, F Han, A Kleinhofs, K. Matsui // Mol Breeding. - 2008. - P.249–259 .

207. Utsugi, S. Structural and functional properties of Viviparous1 genes in dormant wheat / S. Utsugi, S. Nakamura, K. Noda, M. Maekawa //Genes & genetic systems. – 2008. – Т. 83. – №. 2. – P. 153-166 .

208. Utsugi, S., Maekawa, M., and Noda, K. An efficient transient gene expression system using aleurones of diploid wheat seeds / S. Utsugi, M .

Maekawa, K. Noda // Plant Biotechnology. – 2006. – 23. – P. 413–417 .

209. Vasil, V. Overlap of Viviparous1 (VP1) and abscisic acid response elements in the Em promoter: G-box elements are sufficient but not necessary for VP1 transactivation / V. Vasil, W.R. Jr Marcotte, L. Rosenkrans, S.M. Cocciolone, I.K. Vasil, R.S. Quatrano, D.R. McCarty // Plant Cell. - 1995. - Vol.7. - P.1511– 1518 .

210. Von Botmer, R., Seberg,O. & Jacobsen, N. Genetic resources in the Triticeae / R. Von Botmer, O. Seberg, N. Jacobsen // Hereditas. - 1992. – 116. – P .

141-150 .

211. Vos, P. AFLP: a new technique for DNA fingerprinting / P. Vos, R .

Hogers, M. Bleeker, M. Rejans, T. van de Lee, M. Hornes, A. Fritjers, J. Pot, J .

Peleman, M. Kuiper, M. Zabeau // Nucl. Acids Res. - 1995. - Vol.23, №21. P.4407-4414 .

212. Wan, Y. Isolation and characterization of five novel high molecular weight subunit of glutenin genes from Triticum timopheevi and Aegilops cylindrica //Theoretical and Applied Genetics. – 2002. – Т. 104. – №. 5. – P. 828Wang, R. R. C., Hsiao C. Genome relationship between Thinopyrum bessarabicum and T. elongatum: revisited / R. R. C. Wang, C. Hsiao //Genome. – 1989. – Т. 32. – №. 5. – P. 802-809 .

214. Wang, R. R. C. Genome analysis of Thinopyrum bessarabicum and T .

elongatum / R. R. C. Wang //Canadian journal of genetics and cytology. – 1985. – Т. 27. – №. 6. – С. 722-728 .

215. Wang, Q. ERAD inhibitors integrate ER stress with an epigenetic mechanism to activate BH3-only protein NOXA in cancer cells / Q. Wang, H .

Mora-Jensen, M.A. Weniger, P. Perez-Galan, C. Wolford, T. Hai, Y. Ye //Proceedings of the National Academy of Sciences. – 2009. – Т. 106. – №. 7. – P .

2200-2205 .

216. Walker-Simmonds, M.K. ABA levels and sensitivity in developing embryos of sprouting resistant and susceptible cultivars / MK. Walker-Simmonds // Plant Physiol. - 1987. - Vol.84. - P.61–66 .

217. Warner, R.L. Dormancy in wheat-grain mutants of Chinese spring wheat (Triticum aestivum L.) / R.L. Warner, D.A. Kudrna, S.C. Spaeth, S.S. Jones // Grain Sci. Res. - 2000 – 10. – P. 51-60 .

218. West, J.G., Mcintyre, C. L., and Appels, R.. Evolution and systematic relationships in the Triticeae (Poaceae) / J.G. West, C.L. Mcintyre, R.. Appels // Plant Systematics and Evolution. – 1988. – V. 160. – P. 1-28 .

219. Wilkinson M, Lenton J, Holdsworth M. Transcripts of VP-1 homologues are alternatively spliced within the Triticeae tribe. // Euphytica. Vol.143. - P.243–246 .

220. Xia, L. Q. What can the Viviparous-1 gene tell us about wheat preharvest sprouting? / L.Q. Xia, Y. Yang, Y.Z. Ma, X.M. Chen, Z.H. He, M.S .

Rder, P.R. Shewry // Euphytica. – 2009. – Т. 168. – №. 3. – P. 385-394 .

221. Xu, J., Conner, R. L., Laroche, A. C-banding and fluorescence in situ hybridization studies of the wheat-alien hybrid 'Agrotana' / J. Xu, R. L. Conner, A .

Laroche //Genome. – 1994. – Т. 37. – №. 3. – P. 477-481

222. Xu, Y., Crouch, J. H. Marker-assisted selection in plant breeding:

from publications to practice / Y. Xu, J. H. Crouch //Crop Science. – 2008. – Т. 48 .

– №. 2. – P. 391-407 .

223. Yamaguchi-Shinozaki, K., Shinozaki, K. Organization of cis-acting regulatory elements in osmotic-and cold-stress-responsive promoters / K .

Yamaguchi-Shinozaki, K. Shinozaki //Trends in plant science. – 2005. – Т. 10. – №. 2. – С. 88-94 .

224. Yan-Ming, Y. A. N. X. D. Z., Ji-Lin, L. I. Elytrigia Genome Structure of Hybrid Octoploid Trititrigia and Agropyron glaucum [J] / Y. A. N. X. D. Z .

Yan-Ming, L. I. Ji-Lin //Bulletin of Botanical Research. – 2010. – Т. 2. – P. 014 .

225. Yang, Y. Development and validation of a Viviparous-1 STS marker for pre-harvest sprouting tolerance in Chinese wheats /Y. Yang, X.L. Zhao, L.Q .

Xia, X.M. Chen, X.C. Xia, Z. Yu, Z.H. He, M. Roder // Theor. Appl. Genet. – 2007. – 115. – P. 971–980 .

226. Yen, C., Yang, J. L., Yen, Y. Hitoshi Kihara, skell Lve and the modern genetic concept of the genera in the tribe Triticeae (Poaceae) / C. Yen, J .

L. Yang, Y. Yen //Acta Phytotax. Sin. – 2005. – Т. 43. – №. 1. – P. 82-93 .

227. Yuan, W. Y. Production, fertility and cytology of tetrageneric hybrids involving Triticum, Agropyron, Haynaldia and Secale //Wheat Information Service. – 1997. – Т. 84. – С. 13Zanetti, S. Genetic analysis of pre-harvest sprouting resistance in a wheat spelt cross / S Zanetti, M Winzeler, M Keller, B Keller, M. Messmer // Crop Sci. - 2000. - Vol.40. - P.1406–1417 .

229. Zentella, R., Yamauchi, D., and Ho, T. H. Molecular dissection of the gibberellin/abscisic acid signaling pathways by transiently expressed RNA interference in barley aleurone cells / R. Zentella, D. Yamauchi, T.H. Ho // Plant Cell. – 2002. – 14. – P. 2289–2301 .

230. Zhang, H. Genetic analysis and QTL mapping of seed coat color in sesame (Sesamum indicum L.) / H. Zhang, H. Miao, L. Wei, C. Li, R. Zhao, C .

Wang //PLoS One. – 2013. – Т. 8. – №. 5. – P. e63898 .

231. Zhang, L. The crossability of Triticum turgidum with Aegilops tauschii / L. Zhang, Z. Yan, S. Dai, Q. Chen, Z. Yuan, Y. Zheng, D. Liu //Cereal Research Communications. – 2008. – Т. 36. – №. 3. – P. 417-427 .

232. Zhang, L. Development of Ee-chromosome specific AFLP and STS molecular marker for Lophopyrum elongatum in Chinese Spring wheat background / L. Zhang, Z.H. Yan, Y.L. Zheng, D.C. Liu, S.F. Dai, L.Q. Zhang, Y.M. Wei //J. Agric Biotechnol. – 2008. – Т. 16. – №. 3. – P. 465-473 .

233. Zhang, X.Y., Dong, Y.S., Wang, R.R.C. Characterization of genomes and chromosomes in partial amphiploids of the hybrids Triticum aestivum Thinopyrum ponticum by in situ hybridization, isozyme analysis, and RAPD / X.Y .

Zhang, Y.S. Dong, RR.-C. Wang // Genome. – 1996. – 39. – P.1062–1071 .

234. Zhao, H. Development of primers specific for LMW--GS genes at Glu--D3 and Glu--B3 loci and PCR amplification / H. Zhao, A. Guo, S. Hu, S .

Fan, D. Zhang, S. Ren, R. Wang //Zuo wu xue bao. – 2003. – Т. 30. – №. 2. – P .

126-130 .

235. Zheng, Q. Characterization of Species for Wheat Stem Rust Resistance and Ploidy Level / Q. Zheng, D.L. Klindworth, T.L. Friesen, A.F. Liu, Z. Li, S. Zhong, S. Xu S. //Crop Science. – 2014. – Т. 54. – №. 6. – P. 2663-2672

236. Zhou, H., Li, B., Li, Z. The study of breeding blue-grain gene translocation of wheat / H. Zhou, B. Li, Z. Li //Acta Botanica Boreali-Occidentalia Sinica. – 1994. – Т. 15. – №. 2. – P. 125-128 .

237. http://www.agrosoft.biz/agro_travki_zlakovie2.php#b36

238. http://blast.ncbi.nlm.nih.gov/

239. http://www.fao.org/worldfoodsituation/csdb/ru/

–  –  –






Похожие работы:

«ОСТРОВНАЯ ИЗОЛЯЦИЯ И ВИДООБРАЗОВАНИЕ У ВРАНОВЫХ ПТИЦ В ВОСТОЧНОЙ АЗИИ А. П. Крюков, Л. Н. Спиридонова Острова традиционно служат моделями для изучения эволюционных процессов (Wallace, 1880). Близкие к современным очертания восточной окраины Северной Азии начали ф...»

«biologiya_6_klass_ponomareva_gdz_uchebnik_otvety_na_voprosy.zip 4. 5. Выполните лабораторную работу Тема: "Внешнее строение листа". Задание 5. А это позволит не потерять баллы на ВПР и экзаменах. Сезонная периодичность характеризуется сменой температуры. Вывод: Почки называют зачаточным побегом, потому что в...»

«к. "•в ПЕРВАЯ ПОМОШЬ ПРИ НЕОТЛОЖНЫХ СОСТОЯНИЯХ В ЧРЕЗВЫЧАЙНЫХ СИТУАЦИЯХ М о зы рь Министерство образования Республики Беларусь Учреждение образования "Мозырский государственный педагогический университет имени И. П. Шамякина" ПЕРВАЯ ПОМОЩЬ ПРИ НЕОТЛОЖНЫХ СОСТОЯНИЯХ В ЧРЕЗВЫЧАЙНЫХ СИТУАЦИЯХ Рекомендо...»

«Серия "Науки о Земле" ИЗВЕСТИЯ 2009. Том 1, № 1. С. 183–189 Иркутского государственного Онлайн-доступ к журналу: университета http://isu.ru/izvestia УДК 504. 062 Картографическое отображение лесов особ...»

«жизненный цикл клетки Процессы жизненного цикла клеток размножение, дифференцировка и гибель определяют образование, развитие, функционирование и смерть организмов. От них зависит сохранение структурного и генетического гомеостаза, возможность регенерации и восстановления после действия повреждающих факторов. Любые нарушения эт...»

«УДК 637.524.5 ИССЛЕДОВАНИЕ ПРОДУКЦИИ ИЗ МЯСА ПТИЦЫ А.И. Алфимова, магистрантка, alfimovaa94@mail.ru, Л.Т. Серпунина, д-р техн. наук, профессор, И.М . Горностаева, магистрантка, irina_111292@mail.ru Н.А. Притыкина, канд. техн. наук, доцент, Г.В. Жвинклите, магистрантка, gitana.z@mail.ru Ю.В. Мастюгин, преподаватель ФГБОУ ВО "Кал...»

«Владивостокский государственный университет экономики и сервиса Лаборатория химмотологии Применение химических композиций для ранней диагностики и восстановления эксплуатационных характеристик ДВС различных видов транспорта патент Российской Федерации № 2213338, опубл. 27.09.2003, авторы Усольцев А.А....»

«Образовательный проект для детей старшего дошкольного возраста "Пусть пулеметы не строчат и пушки грозные молчат" Реализация образовательного проекта – 03.05.2018г по 09.05.2018г. Вид проекта: краткосрочный групповой проект. Тип проекта: информационно-творческий Продолжительность проекта: 1 неделя Уч...»

«КАЗАНСКИЙ ФЕДЕРАЛЬНЫЙ УНИВЕРСИТЕТ Общеуниверситетская кафедра физической культуры и спорта А.С. Шалавина, Н.Ю. Шафикова, Н.Б. Сергеева РАЗВИТИЕ ГИБКОСТИ СТУДЕНТОВ УЧЕБНО-МЕТОДИЧЕСКОЕ ПОСОБИЕ КАЗАНЬ – 2016 УДК 612.63/66 (075.83) ББК Принято на за...»

«НАУЧНЫЕ ВЕДОМОСТИ Серия Естественные науки. 2011. № 9 (104). Выпуск 15/1 131 УДК 502.9:581.55 (571.56) ГЕМ ЕРОБИАЛЬНОСТЬ РАСТЕНИЙ ЯКУТИИ Б.Н.Пестряков1 М.М.Черосов2 А.Р . Ишбирдин3 Проведено обобщение проводимых исследований 1)Северо-Вост...»

«А К А Д Е МИ Я Н А У К С С С Р СИБИРС I-Ю Е ОТДЕЛЕНИЕ ТРУДЫ ИНСТИТУТА ГЕОЛОГИИ И ГЕОФИЗИКИ выпус к 431 • DEMY O F S C I EN C E S OF Т Н Е U S S R AC A SIВE R IA BRA N NCH ТНЕ T RANSACTIONS O F INSTITUTE OF GEOLOGY AND GEOPHYSICS 1 s s u е...»

«МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УТВЕРЖДАЮ Первый заместитель Министра Р.А. Часнойть 27.09.2010 г. Регистрационный № 061-0610 МЕТОДИКА ОБНАРУЖЕНИЯ И КОЛИЧЕСТВЕННОГО ОПРЕДЕЛЕНИЯ ОПИАТОВ В БИОЛОГИЧЕСКИХ ЖИДКОСТЯХ инструкция по...»

«АО "ИНФОРМАТИКА" Программный комплекс автоматизации природоохранной деятельности предприятия АСМО экология Руководство пользователя Иваново Содержание Введение 1 . Ведение нормативно-справочной информации 2. Объекты природоохра...»

«IBO – 2006 Part B XVII Международная биологическая олимпиада 9 – 16 июля 2006 г., Рио-Куарто, Аргентина Теоретический тест Часть В В2. В эукариотической клетке рибосомы, локализованные в цитозоле, эндоплазматическом ретикулуме, митохондриях и хлоропластах, осуществляют синтез определен...»

«РОССИЙСКАЯ ФЕДЕРАЦИЯ ОРЛОВСКАЯ ОБЛАСТЬ АДМИНИСТРАЦИЯ МЦЕНСКОГО РАЙОНА ПОСТАНОВЛЕНИЕ 12 марта 2015 № 178 Об организации проведения экологической акции "Дни защиты от экологической опасности 2015" В целях реализации постановления Правительства Российской Федерации от 11 июня 1996...»

«WATER PROBLEMS INSTITUTE RUSSIAN ACADEMY OF SCIENCES ECOSYSTEMS: ECOLOGY AND DYNAMICS Vol. 2, No. 3, 2018, September Journal is founded in January 2017 Issued 4 times per year Editor-in-Chief, Dr. geogr. Zh.V. Kuzmina Editorial Council: Corresponding member of the...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ федеральное государственное бюджетное образовательное учреждение высшего образования "РОССИЙСКИЙ ГОСУДАРСТВЕННЫЙ ГИДРОМЕТЕОРОЛОГИЧЕСКИЙ УНИВЕРСИТЕТ" Кафедра Геоэкологии и природопользования полярных...»

«ЛЕЧЕНИЕ НЕРВНЫХ И ПСИХИЧЕСКИХ ЗАБОЛЕВАНИЙ Терапия больных, страдающих головокружением и нарушением равновесия Д.м.н., проф. Л.Н . КОРНИЛОВА1, к.м.н., н.с. В.В. ТЕМНИКОВА1, к.т.н. И.А. НАУМОВ1, д.м.н., в.н.с., проф. А.Д. СОЛОВЬЕВА2 The therapy of patients with dizziness and balance disorders L.N. KORNILOVA,...»

«МЕТОДЫ ОХОТТАКСАЦИИ ПРИ ВНУТРИХОЗЯЙСТВЕННОМ УСТРОЙСТВЕ С ПРИМЕНЕНИЕМ ДИСТАНЦИОННОЙ ИНФОРМАЦИИ 1 2 1,2 ©2010 г. Пузаченко Ю.Г., Желтухин А.С., Сандлерский Р.Б. Институт проблем экологии и эволюции им...»

«ФЕНЕВА Ирина Юрьевна МЕХАНИЗМЫ ВЛИЯНИЯ БИОТИЧЕСКИХ И АБИОТИЧЕСКИХ ФАКТОРОВ НА ДИНАМИКУ И СТРУКТУРУ СООБЩЕСТВ ВЕТВИСТОУСЫХ РАКООБРАЗНЫХ 03.02.10 – гидробиология Диссертация на соискание ученой степени доктора биологических наук Научный консультант, доктор биологических наук, профессор академик Юрий Юлианович Дгебуадзе Москва Содержание...»

«30-49 УДК 504 i пни KZ9900885 Ю.А. Бродская V РАДИОЭКОЛОГИЧЕСКАЯ ОБСТАНОВКА В ГОРОДЕ АЛМАТЫ Действие радиации на человека и окружающую среду приковывает к себе пристальное внимание общественности и вызывает научный и практический интерес. Су...»

«СОДЕРЖАНИЕ Дополнения и изменения в рабочей программе, которые произошли после 1. утверждения программы Цели и задачи освоения дисциплины "Общая геология" 2. Место дисциплины "Общая геология" в структуре основной образовательной 3. программы Результаты о...»




 
2019 www.mash.dobrota.biz - «Бесплатная электронная библиотека - онлайн публикации»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.